primer design for stratagene's quick change mutagenesis
Rick Bright
rbright at rmy.emory.edu
Tue Aug 24 17:32:37 EST 1999
Desalted Oligos are perfect for most mutagenesis that we have done in
our lab. We never pay for any additional purification. If you are
having problems with your reactions, you should ignore everything I say
and go by the book until you can resolve your issues. If all is going
well, you can take the shortcuts and save much money.
Frederik Boernke wrote:
>
> Frederik Boernke wrote:
> >
> > Another Question: Is it really necessary to buy this as a kit, I mean
> > all components are regular PCR reagents/restriction enzymes. We use
> > Turbo Pfu on a regular base and also have some DpnI in the freezer.
> > To use the things we've got to me seems a much cheaper alternativ to
> > the kit, or does it contain anything special that makes it
> > indispensable.
> >
>
> One additional question: Is it really necessary to use HPLC purified
> oligos? Or are desalted just as good, because this could save quiete
> some money.
>
> Ricky
>
> ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG
>
> Frederik Boernke
> Research Group of Molecular Plant Physiology
> Institute for Plant Genetics and Crop Plant Research (IPK)
> Corrensstr. 3
> 06466 Gatersleben
> Tel. 039482 -5 321
> Fax. 039482 -5 515
> http://www.ipk-gatersleben.de
More information about the Methods
mailing list