1hr ligation T-vector kit

John R. McQuiston zje8 at cdc.gov
Fri Feb 12 07:45:57 EST 1999


I would order Invitrogen's (No Aff.) TOPO TA Kit and solve all your problems.  
it has a 5 min RT ligation and I usually get about 50-75% with the correct 
insert the next day (they claim higher). I use BRL Comp cells with it though 
because of an easier protocol.  Also, there's no cleanup involved.  You use 2ul 
of the PCR reaction straight into the ligation.
I've been using this for 2 yrs now and doubt I would switch to anything else 
unless they could improve the efficiency.  But with B/W screening it doesn't 
really matter.  Check it out.


John R. McQuiston






In article <Pine.SUN.3.92.990212081531.6953A-100000 at molecule.bio.uts.edu.au>, 
michelle at MOLECULE.BIO.UTS.EDU.AU says...
>
>
>Hi bionetters,
>
>Promega recently altered their pGEM-T vector kit, so a 1hr ligation can be
>done at RT, although the standard O/N can still be done.  I have used this
>vector in the old form for years, with fairly consistent results, even
>with my homemade competent cells.
>
>I have used the new kit twice, with utterly dismal results each time.
>First, I tried the 1hr ligation, and got nothing.  Being sceptical from the
>outset, I had left the remainder at 4degC O/N, but when I plated it out- also
>nothing. A few days later (I forgot about the plates) there were colonies,
>both blue and white, but they looked wrong.
>I suspected either my plates, or the purity of the insert, so I repeated the
>ligation using fresh plates and new inserts, cleaned up with Qiaquick.
>This time I got a few tiny colonies after about 18hrs incubation, but nothing
>like my usual results.
>
>So, has anyone else out there found a drop-off in efficiency with this new
>variation??  Or do I have to go through the tedium (and expense!) of doing
>all the recommended controls before I whinge to Promega?
>
>thanks,
>
>Michelle
>AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
>Michelle Gleeson
>Molecular Parasitology Unit              Ph: (02) 9514 4043
>University of Technology                 Fax:(02) 9514 4003
>Westbourne St Gore Hill, NSW 2065        michelle.gleeson at uts.edu.au
>AUSTRALIA
>TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
>




More information about the Methods mailing list