Creating T-cloning vector

S. Findley polliwog at u.washington.edu
Sat Feb 20 16:33:06 EST 1999


The following polylinker based on AhdI recognition site will work:
(Stu, Eco and Hd3 sites not important here):

AhdI
GACNNNNNGTC
CTGNNNNNCAG

GACNNN  NNGTC
CTGNN  NNNCAG

GACNNT.......NNGTC
CTGNN.......TNNCAG

Eco RI             StuI             HndIII
GAATTCGACCATATGTCAAGGCCTTGACCCATGGTCAAGCTT
CTTAAGCTGGTATACAGTTCCGGAACTGGGTACCAGTTCGAA 
          AhdI               AhdI

Eco RI               HndIII
GAATTCGACCAT    TGGTCAAGCTT
CTTAAGCTGGT    TACCAGTTCGAA
      AhdI         AhdI
-- 
Seth D. Findley               polliwog at u.washington.edu
Department of Biochemistry    Phone: 206-543-1710
Health Sciences Building J579
University of Washington, Box 357350, Seattle, WA 98195



More information about the Methods mailing list