Cloning nomenclature

Chris H Lindley chris at scotgate2.demon.co.uk
Sat Jun 19 12:52:35 EST 1999


On Fri, 18 Jun 1999 15:14:27 +0100, r_grant at see.sig.for.address wrote:
>In article <2CCB6CA5A8A5D211AFD700A0240AFD6C01DE4673 at MCDC-US-NEWS>,
>zje8 at cdc.gov (John R. McQuiston) wrote:
>
>>We had one a few years back that I liked, pBFP.  It was a very large plasmid.
>
>LOL!
>
>I shall never read the literature in the same light again. . .

Hmmm,

so the vector that never works in ligations is the pMFxx!!

Cheers
Chris



-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
¦  Chris H. Lindley                                  Yorkshire, UK  ¦
¦  chris at scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  ¦
¦  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  ¦
¦  Molecular Biology & OS/2               www.scotgate.demon.co.uk  ¦
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC




More information about the Methods mailing list