RNA isolation
Chris H Lindley
chris at scotgate2.demon.co.uk
Sun Nov 7 17:28:55 EST 1999
On Sun, 07 Nov 1999 23:24:08 +0200, shibolet at mishkei.org.il wrote:
>Hi
>My exprience with Human, Rat, and plant RNA and northern blots leads me to the
>conclusion that RNases aren't a problem in the gel at all, but basic pH
>certainly is. Check your sample buffer or "blue-juice". Use a pair of stirrers
>and cover the gel with a lot of buffer to stop the pH at the cathode from
>turning basic. This happens quite abruptly, depending on your buffer, if you
>don't, and degrades your large RNAs. I have somewhere an excellent MOPS based
>protocol for Northerns that has NEVER failed and includes an equal (and low)
>conc. of formaldehide in gel, buffer, and loading buffer. I actually just change
>the buffers around with an electric dispensor once or twice instead of stirring
>in this protocol. Contact me at amitg at ias.agri.gov.il and I'll look it up for
>you. Samples that do not move at expected speed (or not at all?) may suggest
>wrong salt conc. or immense overloading.
Hi,
What about recirculating the buffer with a peristaltic pump?
(Remebering of course to clean out the tube with the same
care you did the gel tank! H2O2 )
I've tried this many a time, and always seems fine!
(...and running the tube through an ice bath, helps when you're
impatient!!)
Cheers
Chris
>Arnoud van Vliet wrote:
>
>> Hi Patrick,
>>
>> I have been working with RNA from H. pylori for the last couple of months,
>> and I have similar problems. Although I see clear ribosomal RNA bands, my
>> mRNA seems to be degrading as my Northerns give me smears instead of bands.
>>
>> I use the RNeasy kit from Qiagen, and have also used the protocol from the
>> Current protocols book (Ausubel et al, 1992). If you want to, I can attach a
>> file with my protocols. I store my RNA in aqua dest at -80, and that seems
>> to be OK. Are you sure about the Ambion etc stuff?
>>
>> I leave my gel tray and tank for >30 min in >0.1 N NaOH, rinse with aqua
>> dest, and use buffers (if possible) treated with DEPC. I don't stain with
>> EtBR, but I blot them overnight to Nylon filters and then stain with 0.04%
>> methylene blue (Sigma) in 0.5M sodium acetate pH5.2, for 5 min and then
>> destain in distilled water. Then it looks OK.
>>
>> So what are you trying to look at? Maybe we can discuss some possibilities,
>> as this RNA stuff is driving me crazy
>>
>> best wishes
>> Arnoud
>>
>
>> Patrick Baker <baker.599 at OSU.EDU> wrote in message
>> news:4.0.1.19991105164637.00dc8470 at pop.service.ohio-state.edu...
>> > Hello.
>> >
>> > I am working on isolating RNA from Helicobacter pylori; however, I am
>> > having problems with RNA degradation as evident by smears on formaldehyde
>> > gels. My most recent efforts yielded one sample that looked pretty good
>> > (ribosomal RNA bands were visible) but one was smeared and another never
>> > left the well (ethidium bromide stained heavily in the well)!
>> >
>> > I am using RNAzol B to isolate my RNA and I am storing it in RNA Secure
>> > buffer from Ambion. I use all my own reagents and equipment. I do all my
>> > work under a hood and use RNAse Away to inhibit ambient RNases.
>> >
>> > Does anyone have any suggestions what else I can do to avoid RNA
>> degradation?
>> >
>> > Thanks
>> > Patrick
>> >
>> >
>
--
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
¦ Chris H. Lindley Yorkshire, UK ¦
¦ chris at scotgate2.demon.co.uk Ferg on #os/2 and #os2uk, EFnet ¦
¦ WarpUK:UK OS/2 Users group www.warp.in-uk.net ¦
¦ Molecular Biology & OS/2 www.scotgate.demon.co.uk ¦
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC
More information about the Methods
mailing list