DNA Strider for PC
Chris H Lindley
chris at scotgate2.demon.co.uk
Thu Oct 28 15:14:41 EST 1999
On 26 Oct 1999 19:00:05 GMT, jtho at neuron.neurosurgeryery.washington.edu wrote:
>Is there an equivalent of DNA Strider for the PC (windows or linux)? I would
>rather have something free or shareware.
I'd be interested in something like this aswell!!
Sometimes the thoughtpower required to do some simple
stuff with GCG is a little daunting at 9:00am on a
Monday!! (or midnight on Saturday, take your pick!)
Cheers
Chris
--
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
¦ Chris H. Lindley Yorkshire, UK ¦
¦ chris at scotgate2.demon.co.uk Ferg on #os/2 and #os2uk, EFnet ¦
¦ WarpUK:UK OS/2 Users group www.warp.in-uk.net ¦
¦ Molecular Biology & OS/2 www.scotgate.demon.co.uk ¦
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC
More information about the Methods
mailing list