DNA Strider for PC

Chris H Lindley chris at scotgate2.demon.co.uk
Thu Oct 28 15:14:41 EST 1999


On 26 Oct 1999 19:00:05 GMT, jtho at neuron.neurosurgeryery.washington.edu wrote:
>Is there an equivalent of DNA Strider for the PC (windows or linux)?  I would
>rather have something free or shareware.

I'd be interested in something like this aswell!!

Sometimes the thoughtpower required to do some simple
stuff with GCG is a little daunting at 9:00am on a
Monday!! (or midnight on Saturday, take your pick!)

Cheers
Chris


-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
¦  Chris H. Lindley                                  Yorkshire, UK  ¦
¦  chris at scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  ¦
¦  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  ¦
¦  Molecular Biology & OS/2               www.scotgate.demon.co.uk  ¦
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC




More information about the Methods mailing list