DNA Strider for PC

Bruno Cenni cenni at cellbio.unige.ch
Fri Oct 29 02:46:11 EST 1999


I've looking for something like it on PC for a while, but with no success... The
best thing I found was running a Mac emulator (like Executor from ARDI
www.ardi.com) that then runs DNA Stryder or MacPlasMap or Amplify... There are
some compatibility problems, but you could probably live with it. Let me know if
you find a PC software.

Bruno

Chris H Lindley wrote:

> On 26 Oct 1999 19:00:05 GMT, jtho at neuron.neurosurgeryery.washington.edu wrote:
> >Is there an equivalent of DNA Strider for the PC (windows or linux)?  I would
> >rather have something free or shareware.
>
> I'd be interested in something like this aswell!!
>
> Sometimes the thoughtpower required to do some simple
> stuff with GCG is a little daunting at 9:00am on a
> Monday!! (or midnight on Saturday, take your pick!)
>
> Cheers
> Chris
>
> --
> ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
> ¦  Chris H. Lindley                                  Yorkshire, UK  ¦
> ¦  chris at scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  ¦
> ¦  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  ¦
> ¦  Molecular Biology & OS/2               www.scotgate.demon.co.uk  ¦
> TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC




More information about the Methods mailing list