How to see small fragment of DNA ?

Chris H Lindley chris at scotgate2.demon.co.uk
Sat Oct 30 09:04:05 EST 1999


On Fri, 29 Oct 1999 10:38:11 +0200, alaska1 at box43.gnet.pl wrote:
>I`m looking for a system which make a possible checking cutting
>activity of restrictase BspLU11L. I cut some fragmentrs of DNA, but I
>don`t know how to check efficiency of my enzyme. Fragments after
>cutting are 500 and 4 bp big. Is it possible detect that small (4 bp)
>fragments ?

Well never done it, but when I order my primers they usually
come with a digitised gel image (PAGE). (no idea of the % 
or other stuff) So I would assume if you have enough of the DNA 
present a 4bp fragment would show  up if my 20bp primers do!!
Perhaps somebody with actual practical experience would comment?

Cheers
Chris
-- 
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
¦  Chris H. Lindley                                  Yorkshire, UK  ¦
¦  chris at scotgate2.demon.co.uk     Ferg on #os/2 and #os2uk, EFnet  ¦
¦  WarpUK:UK OS/2 Users group                   www.warp.in-uk.net  ¦
¦  Molecular Biology & OS/2               www.scotgate.demon.co.uk  ¦
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC




More information about the Methods mailing list