inducible expression systems

Nancy Phillips phillinj at SLU.EDU
Mon Sep 6 22:18:35 EST 1999


I am considering an inducible expression system for the introduction of
growth-inhibitory gene into specific cancer cell lines. The system choices
seem to be Tet and ecdysone. Commercial Tet systems seem to be the original
Gossen and Bujard system (tTA and rtTA versions) and a retroviral variant
offered by Clontech, and "T-rex" (Yao et al) offered by Invitrogen. The
promoters seem to differ between the Clontech and Invitrogen systems. 

1. What is relative "leakiness" of the systems? (In Real Life) "Leakiness"
is bad, from my perspective, and I would rather take a hit on maximum
transcription than suffer from too much basal transcription.

2. Has anyone compared the systems? Opinions and sad tales welcomed either
to the list or to me. 

Thanks for any input.


Nancy Phillips, M.D.			phone:(314)577-8782
Pathology				fax:(314)268-5120
St. Louis University Hospital		email: phillinj at slu.edu
3635 Vista Ave.
St. Louis, MO, 63110, USA

aacgccaattgctatccccatattctgctaatcccgagcatggac



More information about the Methods mailing list