BAC DNA prep - best largescale method?

Nancy Phillips phillinj at SLU.EDU
Wed Sep 8 15:12:16 EST 1999


Does anyone have a -consistent-, "high-yield" (given their low copy
number), and readily restriction enzyme digestible BAC DNA prep that can be
scaled up to 100 ug yields? I have fiddled with some resin-based kits and
some non-kit variations on the alkaline lysis procedure, and get zip with
qiagen gravity column that works great for cosmids, and inconsistent yield
and generally poorly digestible DNA with alkaline lysis mini-prep procedure
using 5 ml cultures. The variations tried on the alkaline lysis procedure
are substitution of sarcosyl for SDS in the freshly made lysis solution,
and an extra phenol-CHCl3 extraction at teh end. The DNA is generally good
for PCR and for cycle sequencing, but doesn't want to cut.

Suggestions, anyone?


Nancy Phillips, M.D.			phone:(314)577-8782
Pathology				fax:(314)268-5120
St. Louis University Hospital		email: phillinj at slu.edu
3635 Vista Ave.
St. Louis, MO, 63110, USA

aacgccaattgctatccccatattctgctaatcccgagcatggac



More information about the Methods mailing list