tet-regulatable expression problems (NEWBIE)
Nancy Phillips
phillinj at SLU.EDU
Mon Aug 28 22:18:49 EST 2000
Hello, I am using the Clontech RevTet-ON system, which has two MoMuLV-based
vectors, one with neo-alteredTetR, one with hygro-yourfavoritegene (plus
amphotropic packaging line PT67). Expression should be upregulated with
addition of doxycycline. The neo-TetON (CMV promoter for tetR, LTR for neo)
and the hygro-Luciferase (CMV promoter for tetR, LTR for hygro) clones are
as supplied by Clontech.
I created a tumor cell line stable transfectant with the neo-alteredTetR
virus (Tet-ON line). I then infected the bulk (uncloned) stable
transfectant above with the hygro-luciferase virus, to test bulk cells for
response to doxycycline before evaluating individual subclones for high
TetR expression. ZIP. I then decided I needed some kind of positive control
for the Tet response, so I tried to make a stable double transfectant by
infecting the bulk Tet-ON line with hygro-luciferase and selecting with
hygro (and G418). The resulting cells STILL don't respond to doxycycline,
though obviously they are transcribing antibiotic resistance genes just fine.
1. Can the CMV promoter get silenced by methylation while the antibiotic
resistance gene is unaffected? - thereby giving differential expression.
2. If so, how fast does this happen, and is there any way around it?
3. Should I be checking expression of Tet-ON routinely by Northern or RPA
or perhaps by semiquant. PCR? Ditto with Luciferase (though if the Tet-ON
works, that can be assayed functionally) and with "yourfavoritegene"?
4. Could Tet-ON or Luciferase be "broken" (wrong sequence) despite being
straight from manufacturer? Admittedly, I haven't tried multiple colony
picks from the original bacterial transformation, so I suppose there is a
remote possibility that coli done me wrong.
HELP - I am a NEWBIE at expression!
Nancy Phillips, M.D. phone:(314)577-8782
Pathology fax:(314)268-5120
St. Louis University Hospital email: phillinj at slu.edu
3635 Vista Ave.
St. Louis, MO, 63110, USA
aacgccaattgctatccccatattctgctaatcccgagcatggac
---
More information about the Methods
mailing list