IUBio Biosequences .. Software .. Molbio soft .. Network News .. FTP

Corbett Research FTS-1 Thermal Sequencer

Chih-L Han jesehcl at mac.com
Thu Jan 13 04:57:46 EST 2000


Dear News Readers,

Anyone still using using the Corbett Research FTS-1 Thermal Sequencer? Can
you advice where I can get the PCR capillaries and plastic seal plugs?

Thank you very much for your assistance in advance.

please reply to jessehcl at mac.com



          _____
           |_|*     Chih-L Han MD
         {~._.~}       http://macbiomed.cjb.net/
          ( Y )     mailto:jessehcl at mac.com
         ()~*~U)    ICQ:7281420
         (_)-(_)    efax://+1 707 929 0531
         AGCTACGTAAATAATCCTACGGGCACATTGGCAATTGCGTAACG





More information about the Methods mailing list

Send comments to us at biosci-help [At] net.bio.net