Protocol for isolation of total RNA from animal tissues/cells using silica

Chih-L Han jessehcl at mac.com
Sat Jun 3 02:56:38 EST 2000


Dear Molbio gurus,

I understand there is a wide range of commercial kits on the market for
rapid isolation of total RNA. I just wanna a cheap solution to save my
limited research budget.

Thank you very much for your assistance in advance.


Reply yo jessehcl at mac.com


          _____
           |_|*     Chih-L Han MD
         {~._.~}    http://tinman.life.nu/
          ( Y )     mailto:jessehcl at mac.com
         ()~*~U)    ICQ:7281420
         (_)-(_)    efax://+1 707 929 0531
         AGCTACGTAAATAATCCTACGGGCACATTGGCAATTGCGTAACG






More information about the Methods mailing list