Establishing stable cell lines...
Nancy Phillips
phillinj at SLU.EDU
Thu Sep 14 13:29:36 EST 2000
JJ asked: Why won't cells die or express under selection?
Depending on the cell line, 400 ug/ml of G418 may not be enough. Do a kill
curve up to 1000 or 1200 ug/ml. Do you know what percent of your cells get
transfected with your Lipo2K protocol? If not, you could find out with a
beta-gal or GFP plasmid transfection. Even under ideal conditions where 95%
of cells are transiently transfected, only a small percentage (0.1% ?)
actually integrate. Also, to ask an obvious question (sorry), has this cell
line received another neo resistance plasmid before? Another obvious
question, does the G418 kill other cell lines or is it degraded? Good luck.
Nancy Phillips, M.D. phone:(314)577-8782
Pathology fax:(314)268-5120
St. Louis University Hospital email: phillinj at slu.edu
3635 Vista Ave.
St. Louis, MO, 63110, USA
aacgccaattgctatccccatattctgctaatcccgagcatggac
---
More information about the Methods
mailing list