help

wangxuefeng xfwang1973 at 263.net
Tue Jul 10 12:07:30 EST 2001


methods£¬ÄúºÃ£¡

I want to add EcoR-I at 5`and Xho-I at 3` of the IFN-r cDNA,just below:
 atgaaatatacaagttatatcttggcttttcagctctgcatcgttttgggttctcttggctgttactgccaggacccatatgtacaagaagcagaaaaccttaagaaatattttaatgcaggtcattcagatgtagcggataatggaactcttttcttaggcattttgaagaattggaaagaggagagtgacagaaaaataatgcagagccaaattgtctccttttacttcaaactttttaaaaactttaaagatgaccagagcatccaaaagagtgtggagaccatcaaggaagacatgaatgtcaagtttttcaatagcaacaaaaagaaacgagatgacttcgaaaagctgactaattattcggtaactgacttgaatgtccaacgcaaagcaatacatgaactcatccaagtgatggctgaactgtcgccagcagctaaaacagggaagcgaaaaaggagtcagatgctgtttcgaggtcgaagagcatcccagtaa



    I cannot find best primers,I hope someone will help me.

                    ÖÂ
Àñ£¡

            wxf
            xfwang1973 at 263.net

_____________________________________________
IP¿¨¡¢ÉÏÍø¿¨ÈýÕÛÇÀ¹º  http://shopping.263.net/category08.htm
»¨580ÔªÂòÊýÂëÏà»ú£¬ËÍ100ÔªIP¿¨ http://shopping.263.net/category21.htm

---




More information about the Methods mailing list