help

wxf xfwang1973 at 263.net
Sun Jul 29 10:36:04 EST 2001


methods=A3=AC=C4=FA=BA=C3=A3=A1

I want to add EcoR-I at 5`and Xho-I at 3` of the IFN-r cDNA,just=
 below:
 atgaaatatacaagttatatcttggcttttcagctctgcatcgttttgggttctcttggctgtt=
actgccaggacccatatgtacaagaagcagaaaaccttaagaaatattttaatgcaggtcattca=
gatgtagcggataatggaactcttttcttaggcattttgaagaattggaaagaggagagtgacag=
aaaaataatgcagagccaaattgtctccttttacttcaaactttttaaaaactttaaagatgacc=
agagcatccaaaagagtgtggagaccatcaaggaagacatgaatgtcaagtttttcaatagcaac=
aaaaagaaacgagatgacttcgaaaagctgactaattattcggtaactgacttgaatgtccaacg=
caaagcaatacatgaactcatccaagtgatggctgaactgtcgccagcagctaaaacagggaagc=
gaaaaaggagtcagatgctgtttcgaggtcgaagagcatcccagtaa



    I cannot find best primers,I hope someone will help me.

                    =D6=C2
=C0=F1=A3=A1

            wxf
            xfwang1973 at 263.net

---




More information about the Methods mailing list