help

R. Jayakumar jakku at mrna.tn.nic.in
Sun Jul 29 10:58:04 EST 2001


I can help you with this, if you can tell me exactly what you want to do
with the sequence.  Do you need to design a set of primers to amplify a
portion of this sequence with the aforementioned restriction sites at either
ends.  If so, what is the expected size of the product and the length of the
primer you prefer.  I can send you the primer sequence within the hour.
    best of luck
Jayakumar

----- Original Message -----
From: "wxf" <xfwang1973 at 263.net>
To: <methods at hgmp.mrc.ac.uk>
Sent: Sunday, July 29, 2001 9:06 PM
Subject: help


methods¡ê??¨²o?¡ê?

I want to add EcoR-I at 5`and Xho-I at 3` of the IFN-r cDNA,just below:
 atg
aaat
atac
aagt
tata
tctt
ggct
tttc
agct
ctgc
atcg
tttt
gggt
tctc
ttgg
ctgt
tact
gcca
ggac
ccat
atgt
acaa
gaag
caga
aaac
ctta
agaa
atat
ttta
atgc
aggt
catt
caga
tgta
gcgg
ataa
tgga
actc
tttt
ctta
ggca
tttt
gaag
aatt
ggaa
agag
gaga
gtga
caga
aaaa
taat
gcag
agcc
aaat
tgtc
tcct
ttta
cttc
aaac
tttt
taaa
aact
ttaa
agat
gacc
agag
catc
caaa
agag
tgtg
gaga
ccat
caag
gaag
acat
gaat
gtca
agtt
tttc
aata
gcaa
caaa
aaga
aacg
agat
gact
tcga
aaag
ctga
ctaa
ttat
tcgg
taac
tgac
ttga
atgt
ccaa
cgca
aagc
aata
catg
aact
catc
caag
tgat
ggct
gaac
tgtcgccagcagctaaaacagggaagcgaaaaaggagtcagatgctgtttcgaggtcgaagagcatcccagtaa



    I cannot find best primers,I hope someone will help me.

                    ??
¨¤?¡ê?

            wxf
            xfwang1973 at 263.net

---



---




More information about the Methods mailing list