Prediction the function of Novel gene(s)!

Nancy Phillips phillinj at SLU.EDU
Fri Jun 15 16:56:47 EST 2001


I am partial to the BLOCKS suite of motif/conserved sequence prediction
programs. 
blocks.fhcrc.org
Also PROSITE is handy for glycosylation, phosphorylation sites, simple
motifs such as ring fingers, etc etc.
www.expasy.ch/prosite
And this same server has a flock of good programs and links for protein
analysis
www.expasy.ch/tools

bon appetit!


Nancy Phillips, M.D.			phone:(314)577-8782
Pathology				fax:(314)268-5120
St. Louis University Hospital		email: phillinj at slu.edu
3635 Vista Ave.
St. Louis, MO, 63110, USA

aacgccaattgctatccccatattctgctaatcccgagcatggac

---




More information about the Methods mailing list