Plant PCR primers

Dr. Duncan Clark news at hgmp.mrc.ac.uk
Wed Jun 20 03:14:17 EST 2001


In article <3B2F95D6.D89F0D11 at upei.ca>, the eminent Larry Hale at
University of Prince Edward Island wrote
>    Can anyone tell me if they know of any PCR primers that are fairly 
>    reliable across most plant taxa (but more specifically Vaccinium)?

Universal plant primer sequences:

Primer 1: CGAAATCGGTAGACGCTACG
Primer 2: GGGGATAGAGGGACTTGAAC


PCR conditions:

1)      94°C - 1 minute

2)      94°C - 10 seconds  
3)      55°C - 10 seconds       Stages 2-4 repeated for 20-30cycles
4)      72°C - 30 seconds 

>From Taberlet P. et al, Plant. Mol Biol. 17, 1105.

As shown on page 125 of Qiagen 2001 product guide.

They amplify the non-coding intergenic spacer between tRNAs.

Duncan 
-- 
Homogeneous Fluorescent Reporting Systems for Real-Time Quantitative PCR: 

Optimisation, Probe Technology & Future Systems

4-5 September 2001
King Alfred's College, Winchester, UK 

http://www.dera.gov.uk/html/news/events/real_time_quantitative_pcr.htm




More information about the Methods mailing list