PCR optimization
vagos
el36 at le.ac.uk
Mon Jan 16 22:46:00 EST 2006
hello everyone, I would greatly appreciate some help on this one:
I am trying to optimize a 132mer PCR amplification from template
plasmid DNA. There are two versions of template plasmid that differ in
one specific base pair (shown in capital), as follows:
1 gaattcgagagccctgctcgagctgtAgtggggttcccgagcggccaaagggagcagact
>>>>>>>>>>>>>>>
61 ctaaatctgccgtcatcgacttcgaaggttcgaatccttcccccaccaccacggccgaaa
121 ttcggtacccggatccttagcgaaagctaagattttttttacgcgtgagctcgactgact
<<<<<<<<<<<<<<
One version of the plasmid has adenine (A), whereas the other thymine
(T) in its place.
I want to specifically amplify the version that has the adenine (A)
using a complementary Left Primer. Here is my primer design.
OLIGO start len tm gc% any 3' seq
LEFT PRIMER 12 19 59.74 63.16 8.00 0.00
ccctgctcgagctgtagtg
RIGHT PRIMER 143 18 59.17 55.56 6.00 2.00
tcgctaaggatccgggta
Have got any suggestions on how I can achieve complete amplification
of the plasmid with the adenine (A) even if this version is in lower
amount in the plasmid mixture?
I've tried the following methods for achieving specificity:
Increase the annealing temp, decrease the annealing time, primer
booster technique, formamide, and hot start technique.
I've managed to achieve ~ 60% specificity according to agarose gel
electrophoresis. Have you got any ideas on how I could improve on this?
Please note that I cannot use nested primers, because of the nature of
my work.
Any ideas welcome.
Thank u in advance,
Evagelos Liapis, PhD student
More information about the Methods
mailing list