From trondaun from nt.ntnu.no Wed Jan 2 02:36:21 2008 From: trondaun from nt.ntnu.no (Trond Erik Vee Aune) Date: Wed Jan 2 13:04:53 2008 Subject: About signal peptide In-Reply-To: References: Message-ID: WANG XF wrote: > Hello, everyone! > > I have a question about protein secretion. I want to develop a construct as > follows. > > *promoter----protein 1--protease site---signal peptide---protein 2* > > If the two proteins was expressed and cleaved at the protease site, protein > 2 will be secreted into the supernatant? I assume the signal peptide is for Sec-mediated translocation to the E. coli periplasm. E. coli does not efficiently secrete proteins, but over-expression with translocation to periplasm may lead to lysis, addition of chemicals that disrupt the outer membrane may lead to secretion. Some references: Mergulh?o, F. J. M., D. K. Summers and G. A. Monteiro (2005). "Recombinant protein secretion in Escherichia coli." Biotechnol. Adv. 23(3): 177-202. Mergulh?o, F. J. M., M. A. Taipa, J. M. S. Cabral and G. A. Monteiro (2004). "Evaluation of bottlenecks in proinsulin secretion by Escherichia coli." J. Biotechnol. 109(1-2): 31-43. Francetic, O., D. Belin, C. Badaut and A. P. Pugsley (2000). "Expression of the endogenous type II secretion pathway in Escherichia coli leads to chitinase secretion." EMBO. J. 19(24): 6697-6703. Trond Erik From M.Akramraza from tnw.utwente.nl Wed Jan 2 04:03:35 2008 From: M.Akramraza from tnw.utwente.nl (M.Akramraza@tnw.utwente.nl) Date: Wed Jan 2 13:06:40 2008 Subject: Ionic Strength? Message-ID: <945EE1D683E22445AF497E306741793D0542AE32@tnx2.dynamic.tnw.utwente.nl> Dear sir, I need a such programme which help me to calculate ionic strength of a solution Muhammad Akram Raza Solid State Physics, MESA+ Research Institute University of Twente P.O.Box 217,7500 AE Enschede, The Netherlands Room: Hogekamp 5218 Office: +31 53 489 5329 Home: +31 53 478 5635 Mobile: +31 62 1575 378 Fax : +31 53 489 1101 Email: m.akramraza@utwente.nl m.akramraza@tnw.utwente.nl makraze@yahoo.com From jmunro from aquabounty.com Wed Jan 2 14:42:26 2008 From: jmunro from aquabounty.com (James Munro) Date: Wed Jan 2 15:15:03 2008 Subject: protein extraction for use in ELISA Message-ID: Hello, I am hoping for some suggestions for a protein that I am trying to extract for detection in an ELISA. I have a protein that is 22 kDa which is soluble in sodium borate at either a low pH (<4) or high pH (>9). In its pure form I can detects it in a ELISA when using specific antibodies. When the protein is in commercial fish feeds I can not longer detect it. Has any one got an extraction method that I could try? Thanks James From sudhee26 from gmail.com Wed Jan 2 14:11:29 2008 From: sudhee26 from gmail.com (Sudheendra Rao N R) Date: Wed Jan 2 15:15:12 2008 Subject: Confirming successful cDNA synthesis In-Reply-To: <6349829d-268f-45f8-b8aa-3e6a2ea9031f@e6g2000prf.googlegroups.com> References: <6349829d-268f-45f8-b8aa-3e6a2ea9031f@e6g2000prf.googlegroups.com> Message-ID: Hi Neal, 1. The Reason why you are not able to the band in the gel(agarose/polyac i presume) is that you are using some intercalating agent like ethidium bromide which gives fluoresces under UV light. RNA has sec structure hance it can take EtBr..but not cDNA it is single stranded..you will get double stranded dna only if u run a pcr using cDNA. Also cDNA as far as i know does not form any secondary structures hence it cant hold any intercalating agent..and hence no band. 2. In relation to the above paragraph, mRNAs having secondary structure are known to repress the translation and mutation induced in those regions can enhance gene expression. So if ethidium bromide is intercalating in mRNAs then it is in low abundant mRNAs which probably have secondary structure..other wise they are other types of RNAs..i guess mRNA make up a small percentage of total RNA Reply if it did solve on of your question. I am waiting for the aswer to second question of yours :) from others. Others can also educate me about whatever i have said. Sudheendra. On Jan 1, 2008 8:40 AM, wrote: > Hello, > > I am just starting reverse transcription-based PCR in a new lab (it's > the first time that PCR has been attempted here). I have been using > the Protoscript II kit from NEB, but have not seen any bands on my gel > in the end, even using the control rat liver RNA and GAPDH PCR primers > and conditions included in the kit. Incidentally, I have primed the RT > using the supplied anchored oligo dTs. > > I would like to know whether the RT step or the PCR is the problem. I > can't get my hands on any other general PCR primers to other genes at > the moment, which is what I would use to confirm that the RT went > well. I have confirmed that the control total RNA included in the kit > is good, as assayed by running a denaturing RNA gel: both the 28s and > 18s bands were very strong. > > >From what I've read, the typical way to confirm a successful RT is to > include radiolabelled nucleotides during the RT step, and then analyse > the products on a gel afterwards. Since I'd rather not resort to > radioactivity-based experiments, is there any other way that I can use > to confirm that I actually have cDNA? I did try to run a large amount > of the RT reaction on a gel itself to look for signs of cDNAs of > various lengths, but saw nothing. > > I suppose one reason that I saw nothing is that the cDNA may have been > too dilute... can I use standard ethanol precipitation to precipitate > and concentrate my supposed cDNA sample? > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Think before agree Think before you nod but STOP thinking and You Are God From jhhanson from mail.utexas.edu Thu Jan 3 12:30:09 2008 From: jhhanson from mail.utexas.edu (Joseph Hanson) Date: Thu Jan 3 16:05:23 2008 Subject: I-SceI expression plasmid Message-ID: <89977687-90AE-4AD3-9E74-E2C1FFC7767D@mail.utexas.edu> Hi, Does anyone know where I can locate a mammalian I-SceI expression vector? Antibiotic resistance not important, just need to express it as a control in some of the common mammalian cell types. ------------------------------ Joseph Hanson jhhanson@mail.utexas.edu From tcaetano from ua.pt Fri Jan 4 13:38:04 2008 From: tcaetano from ua.pt (=?ISO-8859-1?Q?T=E2nia_Caetano?=) Date: Fri Jan 4 14:47:06 2008 Subject: Bacillus licheniformis transformation Message-ID: <0CB710C8-30DA-41A3-947B-C7F95A3E52B9@ua.pt> Hello everyone We are trying to transform different Bacillus licheniformis strains and I would like to ask if someone knows if the natural competence obtained with Bacillus subtilis is possible for B. licheniformis? Is anyone familiar with such methods to help me out? Thank you very much biotc From biotecprocess from gmail.com Fri Jan 4 15:47:50 2008 From: biotecprocess from gmail.com (Shlomo Pleban) Date: Fri Jan 4 15:52:21 2008 Subject: lipase Message-ID: <5ec09cd60801041247r6ee8a534yf195986ce06bff9d@mail.gmail.com> Hi, Does anyone has recommendation how to run activity gel for lipase Thank you in advance Shlomi From andres from boldrini.org.br Mon Jan 7 15:27:24 2008 From: andres from boldrini.org.br (Andres) Date: Mon Jan 7 21:13:16 2008 Subject: Stable Transfection of T Cells Message-ID: <47828B2B.1EE2CBDD@boldrini.org.br> I'm about to use fugene6 (Roche) to get stable transfectants of jurkat. Have any one had success with this reagents? Could you please provide us with a protocol? andres -- ______________________________________ Jos? Andr?s Yunes Laborat?rio de Biologia Molecular Centro Infantil Boldrini Rua Gabriel Porto, 1270 13083-210 Campinas, SP ? Brasil Fone (019) 37875070, Fax (019) 32893571 From cfs2105 from columbia.edu Mon Jan 7 15:07:32 2008 From: cfs2105 from columbia.edu (Caryn Shechtman) Date: Mon Jan 7 21:13:21 2008 Subject: Sonication of Salmon Sperm Message-ID: <20080107150732.pt4d4mjqsc08w40k@cubmail.cc.columbia.edu> Hi All, Does anyone have a protocol for sonicating salmon sperm DNA (10mg/mL in water). How long at at what amplitude/voltage? Thanks. From arnigambe from gmail.com Tue Jan 8 05:22:10 2008 From: arnigambe from gmail.com (patingsadagat) Date: Tue Jan 8 12:25:17 2008 Subject: Antibody Problems Message-ID: <467348b1-ee72-436f-a36a-5f32fa6d58da@v4g2000hsf.googlegroups.com> Dear All I've been trying to produce antibodies against my protein of interest. At first, I produced a His-6x tagged protein in E. coli and purified the resulting protein using several purification methods. We then sent the protein samples to a local antibody production company. After 2 months, they sent us sera from rabbits before immunization (0 W), 4, 6, 7 and 8 weeks after immunization. They also sent a protein A/G-purified fraction of the 8W serum. However, when I used the serum for immunostaining, I obtained unexpected localization patterns which was similar to that of alpha tubulin localization in HeLa cells. I therefore tested all fractions using tubulin protein and to my dismay, all, including the 0W sera could detect the tubulin protein. I do not totally comprehend just what is going on. Should I continue my attempts to purify my antibody of interest using the recombinant protein (of interest), or is this a futile exercise? Thank you in advance. From dveasna from pasteur-kh.org Tue Jan 8 04:41:34 2008 From: dveasna from pasteur-kh.org (DUONG Veasna) Date: Tue Jan 8 12:25:26 2008 Subject: DNA molecule copy numbers calculation Message-ID: <4783454E.3090204@pasteur-kh.org> From biotecprocess from gmail.com Tue Jan 8 10:40:23 2008 From: biotecprocess from gmail.com (Shlomo Pleban) Date: Tue Jan 8 12:25:30 2008 Subject: Lipase Message-ID: <5ec09cd60801080740w50661780if58c942b98a9b8ac@mail.gmail.com> Hi, Does anyone have a protocol for activity gel for lipase Thank you in advance Shlomo From Darius.Mazeika from fm.vgtu.lt Tue Jan 8 10:29:26 2008 From: Darius.Mazeika from fm.vgtu.lt (Darius Mazeika) Date: Tue Jan 8 12:25:35 2008 Subject: RNase removal Message-ID: <4470.213.190.50.74.1199806166.squirrel@pastas.vgtu.lt> Hello, I have a problem and I need help because I don't know what to do. I need to purify a protein from Tobacco leaves but i can't get rid of RNase contamination. I tried various chromatography media but it doesn't help. Traces of RNase are detected. It can't be from my chromatography system or buffers because I didn't detect any RNase activity. Do you know if APUP sorbents or media with GDP groups might help? I would be greatful for any suggestion. Thanks Darius From pow.joshi from gmail.com Tue Jan 8 14:22:51 2008 From: pow.joshi from gmail.com (Pow Joshi) Date: Tue Jan 8 14:53:34 2008 Subject: RNase removal In-Reply-To: <4470.213.190.50.74.1199806166.squirrel@pastas.vgtu.lt> References: <4470.213.190.50.74.1199806166.squirrel@pastas.vgtu.lt> Message-ID: <710764ea0801081122m99f0cadq4ce48cb7a983e8d5@mail.gmail.com> On 08/01/2008, Darius Mazeika wrote: > > Hello, > > I have a problem and I need help because I don't know what to do. I need > to purify a protein from Tobacco leaves but i can't get rid of RNase > contamination. I tried various chromatography media but it doesn't help. > Traces of RNase are detected. It can't be from my chromatography system or > buffers because I didn't detect any RNase activity. Do you know if APUP > sorbents or media with GDP groups might help? you could use a strategy where you could use a reducing agent like DTT in your sample preparation. This would cleave the disulphides in RNases...however, the caveat is that it will reduce every other protein as well, and especially the ove you are interested in (should it have disulphide linkages). best Pow I would be greatful for any suggestion. > Thanks > Darius > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > From ucgatan from ucl.ac.uk Tue Jan 8 12:55:25 2008 From: ucgatan from ucl.ac.uk (Tom Anderson) Date: Tue Jan 8 14:53:40 2008 Subject: Antibody Problems In-Reply-To: References: <467348b1-ee72-436f-a36a-5f32fa6d58da@v4g2000hsf.googlegroups.com> Message-ID: On Tue, 8 Jan 2008, DK wrote: > In article <467348b1-ee72-436f-a36a-5f32fa6d58da@v4g2000hsf.googlegroups.com>, patingsadagat wrote: > > >I've been trying to produce antibodies against my protein of interest. > >At first, I produced a His-6x tagged protein in E. coli and purified > >the resulting protein using several purification methods. We then sent > >the protein samples to a local antibody production company. After 2 > >months, they sent us sera from rabbits before immunization (0 W), 4, 6, > >7 and 8 weeks after immunization. They also sent a protein A/G-purified > >fraction of the 8W serum. However, when I used the serum for > >immunostaining, I obtained unexpected localization patterns which was > >similar to that of alpha tubulin localization in HeLa cells. I > >therefore tested all fractions using tubulin protein and to my dismay, > >all, including the 0W sera could detect the tubulin protein. I do not > >totally comprehend just what is going on. Should I continue my attempts > >to purify my antibody of interest using the recombinant protein (of > >interest), or is this a futile exercise? > > Of course. Right now you are dealing with the total IgG fraction while > the only reasonably pure antibody is the one purified on antigen > affinity column. On a small scale, you can purify against your blotted > protein band. Right. I was about to ask if your protein had any homology to tubulin, and could be inducing a cross-reacting antibody response, but the key thing is that the pre-immune serum recognises tubulin, so it seems to be that this particular rabbit has a tubulin allergy (well, except that'd be IgE, but you know what i mean). I would imagine that affinity-purifying the antibody would get rid of the cross-reaction; if you can try that with the samples you have and repeat your IF/blot, that should assuage your concerns. Doing it with the pre-immune serum, as a negative control, might also be wise. I think the fact that you have 6his-tagged antigen makes affinity purification a lot easier, if you're prepared to expend some resin on it: bind antigen to column, bind antibody to antigen, wash like the clappers, elute the antibody from the antigen with thiocyanate, cross fingers and hope that antigen doesn't come off too. However, the existence of the tubulin reactivity is going to make life a bit of a pain, since it means your purification has to be really, really good. Or you'll have to add recombinant tubulin to your blocking buffer or something. Any chance you can complain to the antibody company and get them to do it again with a rabbit that isn't already making tubulin antibodies? Maybe they're reusing rabbits! Also, if it's making a lot of anti-tubulin antibodies, that might (might!) mean it's making less anti-your-protein antibodies. tom -- Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E 6BT (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) thomas.anderson@ucl.ac.uk From arnigambe from gmail.com Tue Jan 8 20:41:08 2008 From: arnigambe from gmail.com (patingsadagat) Date: Tue Jan 8 23:58:04 2008 Subject: Antibody Problems References: <467348b1-ee72-436f-a36a-5f32fa6d58da@v4g2000hsf.googlegroups.com> Message-ID: <58734f7c-2842-485d-8045-4dfa11f1e182@21g2000hsj.googlegroups.com> > Right. I was about to ask if your protein had any homology to tubulin, and > could be inducing a cross-reacting antibody response The protein I'm studying does not have any homology to tubulin. > > I think the fact that you have 6his-tagged antigen makes affinity > purification a lot easier, if you're prepared to expend some resin on it: I performed an experiment exploiting the fact that my recombinant protein is 6his-tagged using Reacti-Gel from Pierce. However, I was not able to get enough antibodies. I guess I can try this experiment one more time using tubulin-blocked serum solutions. >Any chance you can complain to the antibody company and get >them to do it again with a rabbit that isn't already making tubulin >antibodies I'm not sure if I can get them to do it all over again. It takes too much time and I am trying to beat a deadline. Thank you so much for your helpful comments and suggestions. From novalidaddress from nurfuerspam.de Wed Jan 9 02:44:49 2008 From: novalidaddress from nurfuerspam.de (WS) Date: Wed Jan 9 13:14:31 2008 Subject: Antibody Problems References: <467348b1-ee72-436f-a36a-5f32fa6d58da@v4g2000hsf.googlegroups.com> <58734f7c-2842-485d-8045-4dfa11f1e182@21g2000hsj.googlegroups.com> Message-ID: <34ba3d3e-6aa1-420e-870c-30cc25d5a0c8@e25g2000prg.googlegroups.com> > I'm not sure if I can get them to do it all over again. It takes too > much time and I am trying to beat a deadline. Hi, In that case, as a fast and almost certainly working approach, you might try to screen a phage display library displaying single-chain antibodies (eg from NEB or the Tomlinson Library or whatever you can get hold of) against your antigen. Then use the phages or the derived single-chains (which usually have a His tag or so) to hybridize to your blot. Detect with anti-His or anti-phage antibodies. Should be practicable in less than 4 weeks. Concerning the company which provided you that nice serum: They should return you at least your money or even offer you or your lab three free immunizations. With a prior check of the rabbits, as DK suggested. Actually, that's so obvious. Why is nobody ever considering that? One needs just a few drops of serum for this easy test. Best of luck, Wolfgang From yvonne.couch from dpag.ox.ac.uk Thu Jan 10 11:06:15 2008 From: yvonne.couch from dpag.ox.ac.uk (Yvonne Couch) Date: Thu Jan 10 15:25:08 2008 Subject: Cloning Problems shRNA Message-ID: <019601c853a2$ba5689a0$2e7a01a3@dpag.ox.ac.uk> Hi all, I'm trying to make the Invitrogen U6 shRNA entry vector pENTR express an shRNA with the following sense sequence CACCGAAGTTAGGACACAGCATCGAAATGCTGTGTCCTAACTTC And the following antisense sequence AAAAGAAGTTAGGACACAGCATTTCGATGCTGTGTCCTAACTTC Both are displayed as 5' and both have overhangs that fit into pENTR. The kit comes with instructions that suggest 1:10 molar ratio of vector to insert. This failed even to produce LacZ clones on the control plate. Upping it to 1:3 bp ratio allowed us to see colonies on the LacZ plate but nothing on the shRNA plate. At the moment I'm using 2ng of vector and 0.12ng of insert but it's still not working. Any ideas what could be going wrong? Cheers Yvonne From tcaetano from ua.pt Thu Jan 10 14:31:55 2008 From: tcaetano from ua.pt (=?ISO-8859-1?Q?T=E2nia_Caetano?=) Date: Thu Jan 10 15:30:19 2008 Subject: high molecular plasmid DNA References: <20F765B1-A0C3-439A-A19E-DB3CE17C53AA@ua.pt> Message-ID: <3C0D5391-52F2-4AFD-BE08-512B7EED0AF1@ua.pt> > Hello everyone > > Does anyone know why in some cases we see (in an 0,8% agarose gel) > plasmid DNA higher than chromosomal DNA? > I know that there are very large plasmids but it is possible to > exist a plasmid bigger than the chromosome? I thought it wasn't > possible. > I thought that is a characteristic of the separation of the agarose > gels but if this is the case, how can we explain it? > > Looking forward to hear from you something > Best wishes > bio From ebs15242 from creighton.edu Thu Jan 10 16:45:58 2008 From: ebs15242 from creighton.edu (Ed Siefker) Date: Thu Jan 10 19:50:59 2008 Subject: denaturing electrophoresis with paraformaldehyde? Message-ID: <47869216.2060900@creighton.edu> Hi, I need to do some denaturing RNA agarose gels. The protocol says I need 37% formaldehyde, I have paraformaldehyde on hand in the lab. Can I make 37% formaldehyde out of this? What's the stoichiometry between PFA and formaldehyde? Thanks lots -Ed From yansun2005 from gmail.com Thu Jan 10 20:05:10 2008 From: yansun2005 from gmail.com (yan sun) Date: Fri Jan 11 12:59:00 2008 Subject: RNA purification Message-ID: Hi guys, I am working on RNA purification using denatured 20% 19:1 acryl/bis gel. before loading, total RNA is ~50 nmole, after running the gel and elution, my target RNA only 5 nmole left. supposed the yield is 18 nmole. I done this before. but I just can not repeat the result as before. I wonder if my RNA degrade already? any problem with Gel or elutor? Thank you for your help, From hroychow from nmsu.edu Thu Jan 10 22:09:51 2008 From: hroychow from nmsu.edu (Dr. Hiranya S. Roychowdhury) Date: Fri Jan 11 12:59:06 2008 Subject: high molecular plasmid DNA In-Reply-To: <3C0D5391-52F2-4AFD-BE08-512B7EED0AF1@ua.pt> References: <20F765B1-A0C3-439A-A19E-DB3CE17C53AA@ua.pt> <3C0D5391-52F2-4AFD-BE08-512B7EED0AF1@ua.pt> Message-ID: <1131.71.210.226.239.1200020991.squirrel@webmail.nmsu.edu> Well, this has never been suficiently explained, nor do I know of any specific investigation into this. I tend to believe that the high MW species may exist as a complex of bacterial chromosome and other proteins. Usually, a clean plasmid prep does not show the HMW bands. It also has nothing to do with the conc. of the agarose gel. >> Hello everyone >> >> Does anyone know why in some cases we see (in an 0,8% agarose gel) >> plasmid DNA higher than chromosomal DNA? >> I know that there are very large plasmids but it is possible to >> exist a plasmid bigger than the chromosome? I thought it wasn't >> possible. >> I thought that is a characteristic of the separation of the agarose >> gels but if this is the case, how can we explain it? >> >> Looking forward to hear from you something >> Best wishes >> bio > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Hiranya S. Roychowdhury, Ph.D. Asst. Professor, Health & Public Services Dona Ana Community College New Mexico State University Las Cruces, NM 88003 From aawara from pontiff-playground.org Fri Jan 11 22:52:25 2008 From: aawara from pontiff-playground.org (Aawara Chowdhury) Date: Sat Jan 12 00:33:34 2008 Subject: high molecular plasmid DNA References: <20F765B1-A0C3-439A-A19E-DB3CE17C53AA@ua.pt> <3C0D5391-52F2-4AFD-BE08-512B7EED0AF1@ua.pt> Message-ID: In , Dr. Hiranya S. Roychowdhury wrote: > Well, this has never been suficiently explained, nor do I know of any > specific investigation into this. I tend to believe that the high MW > species may exist as a complex of bacterial chromosome and other proteins. > Usually, a clean plasmid prep does not show the HMW bands. It also has > nothing to do with the conc. of the agarose gel. Excessive treatment with alkali will cause this to appear. When nicked DNA denatures, it creates a fast-migrating single-stranded circle that is "undigestable" by restriction endonucleases. The other product is linear ssDNA that tends to aggregate (by partial base-pairing) into large complexes that migrates near the well of agarose gels. If you treat minipreps with a single-strand specific nuclease like S1 or mung-bean nuclease both aberrant species (hmw ssDNA, and fast- migrating ssDNA) will disappear. AC -- Email: echo 36434455860060025978157675027927670979097959886449930P | dc From novalidaddress from nurfuerspam.de Sat Jan 12 05:56:51 2008 From: novalidaddress from nurfuerspam.de (WS) Date: Sat Jan 12 12:59:44 2008 Subject: high molecular plasmid DNA References: <20F765B1-A0C3-439A-A19E-DB3CE17C53AA@ua.pt> <3C0D5391-52F2-4AFD-BE08-512B7EED0AF1@ua.pt> Message-ID: <24f34919-398a-4921-87b7-2fc67b03d8a1@j78g2000hsd.googlegroups.com> that means: make the alkaline lysis step in plasmid isolation as short as possible! Some protocols state "5 min", but for standard lab strains of E. coli that's complete overkill. Add SDS/NaOH (lysis solution), mix shortly by snipping with your fingers, put on ice, add neutralizing solution and mix again immediately. Never vortex, as this would shear genomic DNA. Best regards, Wo From hroychow from nmsu.edu Sat Jan 12 19:02:30 2008 From: hroychow from nmsu.edu (Dr. Hiranya S. Roychowdhury) Date: Sun Jan 13 11:37:03 2008 Subject: high molecular plasmid DNA In-Reply-To: References: <20F765B1-A0C3-439A-A19E-DB3CE17C53AA@ua.pt> <3C0D5391-52F2-4AFD-BE08-512B7EED0AF1@ua.pt> Message-ID: <2325.71.210.244.200.1200182550.squirrel@webmail.nmsu.edu> This is a perfectly good explanation. Thank you. Nicking of the plasmid -as well as of the chromosomal pieces - does cause the HMW bands to appear. Another interesting observation is that often a clean and perfectly good prep will show these spurious species on subsequent electrophoresis (especially following storage). > In , > Dr. Hiranya S. Roychowdhury wrote: > >> Well, this has never been suficiently explained, nor do I know of any >> specific investigation into this. I tend to believe that the high MW >> species may exist as a complex of bacterial chromosome and other >> proteins. >> Usually, a clean plasmid prep does not show the HMW bands. It also has >> nothing to do with the conc. of the agarose gel. > > Excessive treatment with alkali will cause this to appear. When nicked > DNA denatures, it creates a fast-migrating single-stranded circle that > is "undigestable" by restriction endonucleases. The other product is > linear ssDNA that tends to aggregate (by partial base-pairing) into > large complexes that migrates near the well of agarose gels. > > If you treat minipreps with a single-strand specific nuclease like > S1 or mung-bean nuclease both aberrant species (hmw ssDNA, and fast- > migrating ssDNA) will disappear. > > AC > -- > Email: echo 36434455860060025978157675027927670979097959886449930P | dc > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Hiranya S. Roychowdhury, Ph.D. Asst. Professor, Health & Public Services Dona Ana Community College New Mexico State University Las Cruces, NM 88003 From bahram_14 from yahoo.com Mon Jan 14 00:30:47 2008 From: bahram_14 from yahoo.com (BAHRAM KAZEMI) Date: Mon Jan 14 13:03:07 2008 Subject: Methods Digest, Vol 32, Issue 10 In-Reply-To: <200801131703.m0DH3kL21820@net.bio.net> Message-ID: <243416.42592.qm@web51412.mail.re2.yahoo.com> I will clone and express the 16 KDa protein gene of echinococcus granolusus, but I don`t find its sequence in gene bank ( echinococcus complete genome or mRNA of mentioned gene) Bahram Kazemi methods-request@oat.bio.indiana.edu wrote: Send Methods mailing list submissions to methods@net.bio.net To subscribe or unsubscribe via the World Wide Web, visit http://www.bio.net/biomail/listinfo/methods or, via email, send a message with subject or body 'help' to methods-request@net.bio.net You can reach the person managing the list at methods-owner@net.bio.net When replying, please edit your Subject line so it is more specific than "Re: Contents of Methods digest..." Today's Topics: 1. Re: high molecular plasmid DNA (WS) 2. Re: high molecular plasmid DNA (Dr. Hiranya S. Roychowdhury) ---------------------------------------------------------------------- Message: 1 Date: Sat, 12 Jan 2008 02:56:51 -0800 (PST) From: WS Subject: Re: high molecular plasmid DNA To: methods@net.bio.net Message-ID: <24f34919-398a-4921-87b7-2fc67b03d8a1@j78g2000hsd.googlegroups.com> Content-Type: text/plain; charset=ISO-8859-1 that means: make the alkaline lysis step in plasmid isolation as short as possible! Some protocols state "5 min", but for standard lab strains of E. coli that's complete overkill. Add SDS/NaOH (lysis solution), mix shortly by snipping with your fingers, put on ice, add neutralizing solution and mix again immediately. Never vortex, as this would shear genomic DNA. Best regards, Wo ------------------------------ Message: 2 Date: Sat, 12 Jan 2008 17:02:30 -0700 (MST) From: "Dr. Hiranya S. Roychowdhury" --------------------------------- Subject: Re: high molecular plasmid DNA To: aawara@pontiff-playground.org Cc: methods@magpie.bio.indiana.edu Message-ID: <2325.71.210.244.200.1200182550.squirrel@webmail.nmsu.edu> Content-Type: text/plain;charset=iso-8859-1 This is a perfectly good explanation. Thank you. Nicking of the plasmid -as well as of the chromosomal pieces - does cause the HMW bands to appear. Another interesting observation is that often a clean and perfectly good prep will show these spurious species on subsequent electrophoresis (especially following storage). > In , > Dr. Hiranya S. Roychowdhury --------------------------------- wrote: > >> Well, this has never been suficiently explained, nor do I know of any >> specific investigation into this. I tend to believe that the high MW >> species may exist as a complex of bacterial chromosome and other >> proteins. >> Usually, a clean plasmid prep does not show the HMW bands. It also has >> nothing to do with the conc. of the agarose gel. > > Excessive treatment with alkali will cause this to appear. When nicked > DNA denatures, it creates a fast-migrating single-stranded circle that > is "undigestable" by restriction endonucleases. The other product is > linear ssDNA that tends to aggregate (by partial base-pairing) into > large complexes that migrates near the well of agarose gels. > > If you treat minipreps with a single-strand specific nuclease like > S1 or mung-bean nuclease both aberrant species (hmw ssDNA, and fast- > migrating ssDNA) will disappear. > > AC > -- > Email: echo 36434455860060025978157675027927670979097959886449930P | dc > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Hiranya S. Roychowdhury, Ph.D. Asst. Professor, Health & Public Services Dona Ana Community College New Mexico State University Las Cruces, NM 88003 ------------------------------ _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods End of Methods Digest, Vol 32, Issue 10 *************************************** Bahram Kazemi Ph.D., Associate Professor 1- Parasitology Department 2- Cellular and Molecular Biology Research Center Shaheed Beheshti University of Medical Sciences, Tehran, I.R. Iran PO Box: 19395 -4719 Telefax: +98 21 22428432 url: www.bahramkazemi.ir E-mail: bahram_14@yahoo.com bahram14@gmail.com kazemi@sbmu.ac.ir bahram_14@hotmail.com bahram14@irimc.org --------------------------------- Be a better friend, newshound, and know-it-all with Yahoo! Mobile. Try it now. From senkova from afnet.uniag.sk Mon Jan 14 05:46:47 2008 From: senkova from afnet.uniag.sk (senkova@afnet.uniag.sk) Date: Mon Jan 14 13:03:13 2008 Subject: DNA extraction from embryo Message-ID: <1200307607.478b3d972ed74@webmail.uniag.sk> Hello, Have you ever heard about DNA extraction from embryo from barley, or wheat? Thank you and I wish you nice day. Slavomira Senkova Slovak Agricultural Univ. From Anup.SHARMA from svhm.org.au Mon Jan 14 20:59:51 2008 From: Anup.SHARMA from svhm.org.au (SHARMA Anup R) Date: Tue Jan 15 09:44:09 2008 Subject: transfection of THP-1 cells Message-ID: Dear Dr. Simon Mauch, I' m Anup Sharma, a PhD student at University of Melboune, as mentioned I tried transecting THP-1 cells but in vain. Did transfect them on a different model of BTX electroporater ECM 830. Could it will be possible for you to throw some light on the above and getting them transfected. Thanking you Regards, Anup Disclaimer : The contents of this e-mail including any attachments are intended only for the person or entity to which this e-mail is addressed and may contain confidential, privileged and/or commercially sensitive material. If you are not, or believe you may not be, the intended recipient, please advise the sender immediately by return e-mail, delete this e-mail and destroy any copies. ______________________________________________________________________ This email has been scanned by the MessageLabs Email Security System. For more information please visit http://www.messagelabs.com/email ______________________________________________________________________ From timegg113 from gmail.com Tue Jan 15 11:36:35 2008 From: timegg113 from gmail.com (Tim Eggleston) Date: Tue Jan 15 11:47:37 2008 Subject: Transfecting IMR90 cells Message-ID: I was wondering if anyone has attempted to transfect IMR90 fibroblast cells using a Lipofectamine or calcium phosphate transfection. If so, how well did it work? Thanks. Tim Eggleston -- Tim Eggleston Horne Lab Research Assistant 2-505 Bowen Science Building University of Iowa From acuzange from polyplus-transfection.com Tue Jan 15 11:55:06 2008 From: acuzange from polyplus-transfection.com (Alain CUZANGE) Date: Tue Jan 15 15:01:29 2008 Subject: Transfecting IMR90 cells References: Message-ID: <8EF3B568892C4F4D8C0B975D5557CF5FC91635@srvburnav.polyplus-trans fection.local> Hi Tim Would you like to transfect DNA or siRNA? Alain acuzange@polyplus-transfection.com -----Message d'origine----- De?: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] De la part de Tim Eggleston Envoy??: mardi 15 janvier 2008 17:37 ??: methods@magpie.bio.indiana.edu Objet?: Transfecting IMR90 cells I was wondering if anyone has attempted to transfect IMR90 fibroblast cells using a Lipofectamine or calcium phosphate transfection. If so, how well did it work? Thanks. Tim Eggleston -- Tim Eggleston Horne Lab Research Assistant 2-505 Bowen Science Building University of Iowa _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods From timegg113 from gmail.com Tue Jan 15 15:31:33 2008 From: timegg113 from gmail.com (Tim Eggleston) Date: Tue Jan 15 16:31:33 2008 Subject: Transfecting IMR90 cells In-Reply-To: <-2556763346104329530@unknownmsgid> References: <-2556763346104329530@unknownmsgid> Message-ID: I would like to transfect DNA. Thank you for your help. Tim On Jan 15, 2008 10:55 AM, Alain CUZANGE wrote: > Hi Tim > Would you like to transfect DNA or siRNA? > Alain > acuzange@polyplus-transfection.com > > -----Message d'origine----- > De: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] De la part de Tim Eggleston > Envoy?: mardi 15 janvier 2008 17:37 > ?: methods@magpie.bio.indiana.edu > Objet: Transfecting IMR90 cells > > > I was wondering if anyone has attempted to transfect IMR90 fibroblast > cells using a Lipofectamine or calcium phosphate transfection. If so, > how well did it work? Thanks. > > Tim Eggleston > > -- > Tim Eggleston > Horne Lab > Research Assistant > 2-505 Bowen Science Building > University of Iowa > > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Tim Eggleston Horne Lab Research Assistant 2-505 Bowen Science Building University of Iowa From biotaniat from gmail.com Wed Jan 16 14:24:30 2008 From: biotaniat from gmail.com (biotc biotc) Date: Wed Jan 16 15:17:57 2008 Subject: sodium succinate Message-ID: <9323dc540801161124yaf1ca42h889c31b2734ea37@mail.gmail.com> Hello Does anybody know if sodium succinate is similar or even the same as sodium maleate? Which is their function in a bacterial culture medium? Thank you very much for your precious help TC From engelbert_buxbaum from hotmail.com Wed Jan 16 12:00:32 2008 From: engelbert_buxbaum from hotmail.com (Dr Engelbert Buxbaum) Date: Wed Jan 16 15:18:14 2008 Subject: sequence of polymeric proteins References: Message-ID: Am 28.11.2007, 07:54 Uhr, schrieb Esmaeil Sadroddiny : > I am working on polymeric proteins and I need to find sequence data > about all chains of protein in data basis. Dose anybody knows which data > basis is the best. http://www.bioinf.manchester.ac.uk/dbbrowser/OWL/ can be used to comfortably search for sequences. http://www.brenda-enzymes.info/ gives general infos on proteins and has crosslinks to sequence and structure information. From engelbert_buxbaum from hotmail.com Wed Jan 16 12:07:10 2008 From: engelbert_buxbaum from hotmail.com (Dr Engelbert Buxbaum) Date: Wed Jan 16 15:18:19 2008 Subject: how to calculate Kcat value of enzyme References: <37197b5c-9d53-4560-acb3-2abc2f313ca2@a35g2000prf.googlegroups.com> Message-ID: Am 10.12.2007, 07:28 Uhr, schrieb : > Good evening > molecular weight of enzyme is 60 kDa and I took 4 ug of it in each > reaction. Vmax and km values were obtained as 1.24 mmole/min/mg > protein and mM. so how could i calculate Kcat value of the enzyme ? > I will be very grateful for your kind cooperation. From your data you can first calcualte the molar amount of enzyme per reaction. Then re-express the velocity as mmole/min/mmole = 1/min, convert min to sec and you have the turnover number in 1/s = kat. If you have problems with any of that, ask your instructor to go through the calculation with you. From engelbert_buxbaum from hotmail.com Wed Jan 16 12:26:29 2008 From: engelbert_buxbaum from hotmail.com (Dr Engelbert Buxbaum) Date: Wed Jan 16 15:18:23 2008 Subject: Ionic Strength? References: Message-ID: Am 02.01.2008, 05:03 Uhr, schrieb : > I need a such programme which help me to calculate ionic strength of a > solution You can easily do that by hand, simply add the concentration of all the components. Note that we need the concentration of particles, that is, 1 M NaCl is 2 osm (1 osm Na+ and 1 osm Cl-). From ucgatan from ucl.ac.uk Wed Jan 16 15:53:42 2008 From: ucgatan from ucl.ac.uk (Tom Anderson) Date: Wed Jan 16 16:50:53 2008 Subject: Ionic Strength? In-Reply-To: References: Message-ID: On Wed, 16 Jan 2008, Dr Engelbert Buxbaum wrote: > Am 02.01.2008, 05:03 Uhr, schrieb : > > > I need a such programme which help me to calculate ionic strength of a > > solution > > You can easily do that by hand, simply add the concentration of all the > components. The concentration multiplied by half the square of their charge, i think you meant to say. > Note that we need the concentration of particles, that is, 1 M > NaCl is 2 osm (1 osm Na+ and 1 osm Cl-). Osmoles? Hang on, are we calculating ionic strength or osmolarity here? Whichever, it's not quite as simple as just adding things up if there are weak acids and bases involved. If you know the pH of the solution, you first have to calculate the fraction of ionisation of any such species (and if they're polyprotic or polybasic, the fraction of each of the ions), so that you have the actual concentrations (including of H+/OH-!) to do the adding up. If you don't know the pH, then you first need to calculate that from the concentrations and pKas of the ingredients, and that can be a real pain. Especially since the effective pKa varies according to the ionic strength ... Simpler just to make the solution up, measure the pH, and go from there! Hmm. I know you can measure osmolarity directly, but is there an instrument which measures ionic strength? tom -- Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E 6BT (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) thomas.anderson@ucl.ac.uk From yvonne.couch from dpag.ox.ac.uk Thu Jan 17 07:46:33 2008 From: yvonne.couch from dpag.ox.ac.uk (Yvonne Couch) Date: Thu Jan 17 09:59:42 2008 Subject: Calculating Protein Concentration Message-ID: <006101c85906$fda11f90$2e7a01a3@dpag.ox.ac.uk> I have two proteins of different molecular weights, how do I calculate the molarity of any solution I dissolve them in? For example Protein 1 is 15kDa and 1mg is dissolved in 1ml of water, how do I calculate how many moles this is? From biotaniat from gmail.com Thu Jan 17 10:25:35 2008 From: biotaniat from gmail.com (biotc biotc) Date: Thu Jan 17 12:38:51 2008 Subject: sodium succinate Message-ID: <9323dc540801170725r3870acc0p77da81ca39f5bf32@mail.gmail.com> Hello Does anybody know if sodium succinate is similar or even the same as sodium maleate? Which is their function in a bacterial culture medium? Thank you very much for your precious help biotc From R.Jayakumar from roswellpark.org Thu Jan 17 11:28:34 2008 From: R.Jayakumar from roswellpark.org (Jayakumar, R) Date: Thu Jan 17 12:38:57 2008 Subject: Calculating Protein Concentration In-Reply-To: <006101c85906$fda11f90$2e7a01a3@dpag.ox.ac.uk> References: <006101c85906$fda11f90$2e7a01a3@dpag.ox.ac.uk> Message-ID: <97101976F8A044468CA74FE11883B90E173E7997@VISTA.roswellpark.org> You need the amino acid sequence to calculate its molecular weight. Get the protein amino acid sequence from NCBI, paste it into a tool like protparam. http://au.expasy.org/tools/protparam.html It will calculate the molecular weight of the protein for you. Calculate the molarity from that. Jay -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of Yvonne Couch Sent: Thursday, January 17, 2008 7:47 AM To: methods@magpie.bio.indiana.edu Subject: Calculating Protein Concentration I have two proteins of different molecular weights, how do I calculate the molarity of any solution I dissolve them in? For example Protein 1 is 15kDa and 1mg is dissolved in 1ml of water, how do I calculate how many moles this is? _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods This email message may contain legally privileged and/or confidential information. If you are not the intended recipient(s), or the employee or agent responsible for the delivery of this message to the intended recipient(s), you are hereby notified that any disclosure, copying, distribution, or use of this email message is prohibited. If you have received this message in error, please notify the sender immediately by e-mail and delete this email message from your computer. Thank you. From ucgatan from ucl.ac.uk Thu Jan 17 14:40:08 2008 From: ucgatan from ucl.ac.uk (Tom Anderson) Date: Thu Jan 17 17:12:09 2008 Subject: Calculating Protein Concentration In-Reply-To: References: Message-ID: On Thu, 17 Jan 2008, DK wrote: > In article , "Yvonne Couch" wrote: > > >I have two proteins of different molecular weights, how do I calculate > >the molarity of any solution I dissolve them in? For example Protein 1 > >is 15kDa and 1mg is dissolved in 1ml of water, how do I calculate how > >many moles this is? > > For this calculation you'll need to learn how molarity is defined... Which, since Yvonne is a technician in a hurry, i shall (try to) explain. Molarity, aka concentration, is the number of moles of something divided by the volume it's in. If you don't know the number of moles, but you know how much of the thing you have by mass, and the molecular mass of it, you can work it out. Molecular mass is defined as the mass of one mole of something (kinda), with a dalton (Da) being one gram per mole, so you just divide the mass by the molecular mass. So, 1 mg of a 15 kDa protein is 0.001 g / 15000 g/mol = 0.000000067 mol, or 67 nmol. 67 nmol / 0.001 l = 67 uM. 67 nanomoles may not sound like a lot, but don't worry, it's still 40 thousand million million molecules. tom -- Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E 6BT (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) thomas.anderson@ucl.ac.uk From gulozgur from gmail.com Thu Jan 17 17:03:23 2008 From: gulozgur from gmail.com (gulozgur) Date: Thu Jan 17 19:28:54 2008 Subject: Lipase References: Message-ID: <2a29e686-1b5b-42d2-9ef3-4bcf2838cc2a@c4g2000hsg.googlegroups.com> On Jan 8, 5:40?pm, "Shlomo Pleban" wrote: > Hi, > Does anyone have a protocol for activity gel for lipase > Thank you in advance > Shlomo hi, you can find detailed protocols from below papers. Direct Fluorescence-Based Lipase Activity Assay Pilar Diaz, N?ria Prim and F.I. Javier Pastor BioTechniques Vol. 27, No. 4: pp 693-700 (Oct 1999) Rapid Zymogram for Lipase Raman P. Yadav, Rajendra K. Sexena, Rani Gupta and W. Sheba Davidson BioTechniques Vol. 24, No. 5: pp 754-756 (May 1998) best, ozgur From novalidaddress from nurfuerspam.de Thu Jan 17 17:44:06 2008 From: novalidaddress from nurfuerspam.de (WS) Date: Thu Jan 17 19:28:59 2008 Subject: sodium succinate References: Message-ID: Almost. Maleate has two hydrogens less and a double bond more. Wikipedia or online catalogues that http://www.sial.com have nice structural formulae which explain the difference well. Wo From stewjw from gmail.com Fri Jan 18 04:02:34 2008 From: stewjw from gmail.com (StewJW) Date: Fri Jan 18 08:53:16 2008 Subject: Calculating Protein Concentration References: Message-ID: On 17 Jan, 12:46, "Yvonne Couch" wrote: > I have two proteins of different molecular weights, how do I calculate the > molarity of any solution I dissolve them in? ?For example Protein 1 is 15kDa > and 1mg is dissolved in 1ml of water, how do I calculate how many moles this > is? so 1 mg / ml or 0.001 g / ml 0.001 / 15 000 = 66.66 nmol /ml (66.66 x 10^-9 mole / ml) or 66.66 x 1000 = 66.66 ?mol / L or 66.66 ?M (M = Molar = mol / L) From akhan357 from sbcglobal.net Fri Jan 18 12:40:02 2008 From: akhan357 from sbcglobal.net (AK) Date: Fri Jan 18 13:39:51 2008 Subject: Calculating Protein Concentration References: Message-ID: It is amazing to me that this basic question was honored here, perhaps since she is from Oxford. I remember not too long ago a student was hammered to death because of asking a basic question of plant extraction. UNFAIR. AK "Yvonne Couch" wrote in message news:mailman.219.1200581980.2451.methods@net.bio.net... >I have two proteins of different molecular weights, how do I calculate the > molarity of any solution I dissolve them in? For example Protein 1 is > 15kDa > and 1mg is dissolved in 1ml of water, how do I calculate how many moles > this > is? > From novalidaddress from nurfuerspam.de Fri Jan 18 14:45:26 2008 From: novalidaddress from nurfuerspam.de (WS) Date: Fri Jan 18 16:05:29 2008 Subject: Calculating Protein Concentration References: Message-ID: <7407d00a-76f3-4dea-be64-994ec2df50e9@v4g2000hsf.googlegroups.com> Dear AK, seems that even at famous Oxford either the students or the teaching have become worse... Actually, this stuff is a sort of "first day, first lesson's knowledge" in almost any subject related to natural science. More to worry, a PhD (!) student in my lab asked me exactly the same question a few days ago, too. The funny thing is, when I told him to treat the problem the same way as to make a sodium chloride solution, he could solve the problem instantly. What makes me especially worry is that this kind of questions in this NG constantly seems to increase. I do not think it just lazyness, as for a newbie to find this NG on the web, usually, you need to have done some googling before on behalf of your actual problem. My impression is that many of those girls&guys really don't know how to solve their problems and somehow manage to discover the bionet. Hey students, please comment on this, your opinion and experience is wanted here!!! Did nobody teach you these things, do you not know where to find this kind of textbooks and lessens or are you really just lazy? Hey experts, is there any book/website/pdf/etc like {Mathematics, Chemistry, Logical Thinking, Statistics, Planning Experiments and Evaluating Experimental Data} in {Biochemistry, Molecular Biology, Life Science} for Dummies? Any ideas? Wo On 18 Jan., 18:40, "AK" wrote: > It is amazing to me that this basic question was honored here, perhaps since > she is from Oxford. I remember not too long ago a student was hammered to > death because of asking a basic question of plant extraction. UNFAIR. > AK From R.Jayakumar from roswellpark.org Fri Jan 18 17:30:02 2008 From: R.Jayakumar from roswellpark.org (Jayakumar, R) Date: Sat Jan 19 14:10:44 2008 Subject: Calculating Protein Concentration In-Reply-To: <7407d00a-76f3-4dea-be64-994ec2df50e9@v4g2000hsf.googlegroups.com> References: <7407d00a-76f3-4dea-be64-994ec2df50e9@v4g2000hsf.googlegroups.com> Message-ID: <97101976F8A044468CA74FE11883B90E173E799E@VISTA.roswellpark.org> Well.. The issue of poor mathematical knowledge arises from the basic levels of education. At school levels and even at college levels, the use of calculators have become rampant and necessary. Students should be asked to work mathematical problems with their head, as we all used to do and as several older scientists still continue doing so. using calculators are making that part of the brain redundant and creating these problems in students. Ban calculators at least up to high school levels and the next generation of students would be more mathematics savy. Jay -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of WS Sent: Friday, January 18, 2008 2:45 PM To: methods@magpie.bio.indiana.edu Subject: Re: Calculating Protein Concentration Dear AK, seems that even at famous Oxford either the students or the teaching have become worse... Actually, this stuff is a sort of "first day, first lesson's knowledge" in almost any subject related to natural science. More to worry, a PhD (!) student in my lab asked me exactly the same question a few days ago, too. The funny thing is, when I told him to treat the problem the same way as to make a sodium chloride solution, he could solve the problem instantly. What makes me especially worry is that this kind of questions in this NG constantly seems to increase. I do not think it just lazyness, as for a newbie to find this NG on the web, usually, you need to have done some googling before on behalf of your actual problem. My impression is that many of those girls&guys really don't know how to solve their problems and somehow manage to discover the bionet. Hey students, please comment on this, your opinion and experience is wanted here!!! Did nobody teach you these things, do you not know where to find this kind of textbooks and lessens or are you really just lazy? Hey experts, is there any book/website/pdf/etc like {Mathematics, Chemistry, Logical Thinking, Statistics, Planning Experiments and Evaluating Experimental Data} in {Biochemistry, Molecular Biology, Life Science} for Dummies? Any ideas? Wo On 18 Jan., 18:40, "AK" wrote: > It is amazing to me that this basic question was honored here, perhaps > since she is from Oxford. I remember not too long ago a student was > hammered to death because of asking a basic question of plant extraction. UNFAIR. > AK _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods This email message may contain legally privileged and/or confidential information. If you are not the intended recipient(s), or the employee or agent responsible for the delivery of this message to the intended recipient(s), you are hereby notified that any disclosure, copying, distribution, or use of this email message is prohibited. If you have received this message in error, please notify the sender immediately by e-mail and delete this email message from your computer. Thank you. From terranelliott816 from hotmail.com Fri Jan 18 17:08:20 2008 From: terranelliott816 from hotmail.com (Terran) Date: Sat Jan 19 14:10:50 2008 Subject: Calculating Protein Concentration Message-ID: I too thought this question seemed so silly, and to investigate the simplicity of the answer: I searched "Dalton definition" at www.google.com Looking for an .edu site I found: Dalton = measure of molecular weight or mass. One hydrogen atom has mass of 1 Da. Proteins and other macromolecule molecular weights are usually measured in kDa or kD (kilodaltons) - 1000 Da. From (http://www.biochem.northwestern.edu ) I didn't know the exact answer in the beginning, but from the definition it is a simple conversion problem. Freshmen with general chemistry could solve this. Simple laziness. ~Terran Graduate student Chemical and Biological Engineering Dept South Dakota School of Mines and Technology Rapid City, SD 57701 -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of WS Sent: Friday, January 18, 2008 12:45 PM To: methods@magpie.bio.indiana.edu Subject: Re: Calculating Protein Concentration Dear AK, seems that even at famous Oxford either the students or the teaching have become worse... Actually, this stuff is a sort of "first day, first lesson's knowledge" in almost any subject related to natural science. More to worry, a PhD (!) student in my lab asked me exactly the same question a few days ago, too. The funny thing is, when I told him to treat the problem the same way as to make a sodium chloride solution, he could solve the problem instantly. What makes me especially worry is that this kind of questions in this NG constantly seems to increase. I do not think it just lazyness, as for a newbie to find this NG on the web, usually, you need to have done some googling before on behalf of your actual problem. My impression is that many of those girls&guys really don't know how to solve their problems and somehow manage to discover the bionet. Hey students, please comment on this, your opinion and experience is wanted here!!! Did nobody teach you these things, do you not know where to find this kind of textbooks and lessens or are you really just lazy? Hey experts, is there any book/website/pdf/etc like {Mathematics, Chemistry, Logical Thinking, Statistics, Planning Experiments and Evaluating Experimental Data} in {Biochemistry, Molecular Biology, Life Science} for Dummies? Any ideas? Wo On 18 Jan., 18:40, "AK" wrote: > It is amazing to me that this basic question was honored here, perhaps since > she is from Oxford. I remember not too long ago a student was hammered to > death because of asking a basic question of plant extraction. UNFAIR. > AK _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods From L.Kamalian from liverpool.ac.uk Fri Jan 18 17:49:02 2008 From: L.Kamalian from liverpool.ac.uk (Kamalian, Laleh) Date: Sat Jan 19 14:11:05 2008 Subject: Stable transfection in suspension cells Message-ID: <06F5492E-EB0C-4C96-BEF9-A64B44AA2B8B@mimectl> Hi to everyone. I am a PhD student and new to this mail list. I have a problem I would like to ask. I am working with cells which grow in suspension. I have managed to get a good nock down in transient transfection using a plasmid vector and Lipofectamine as the transfection reagent. Now I am ready to perform the stable transfection. However I haven't got a clue how I will be able to separate the dead cells from the live ones in the selection process especially after the massive death happens. Furthermore, I don't know how I'm supposed to pick a single clone even if I manage to get the live ones. No one in our lab has ever transfected cells in suspension. The selection method I will use is antibody selection (G418) for which I have already started the optimization experiment in order to obtain the killing curve. I was wondering if any of you have worked with suspension cells. Could you please give me some help? Thanks Laleh. From novalidaddress from nurfuerspam.de Sat Jan 19 15:01:46 2008 From: novalidaddress from nurfuerspam.de (WS) Date: Sun Jan 20 17:10:15 2008 Subject: Stable transfection in suspension cells References: Message-ID: Dear Laleh, you could try this: make a dilution of your cells that you have 5-10 cells per ml. Then seed 100ul in each well of a microplate (a total up 2-5 plates) under selection conditions. You'll get approx 1 cell per well. Then watch them become more (or not). You might use a medium containing 50% conditioned medium from 293 HEK (or similar well growing cells), just take the not too much used medium and filter through a syringe filter in order to remove any cells. Then you cells they don't feel so lonely, means they get some growth factors and grow more easily. Then expand those wells where your cells grow (into 24 well plates) and check aliquots for gene expression. You might re- check your cells for expression from time to time, as there is some chance that a) those loosing the transgene overgrow your culture and b) that you had more than 1 cell in the initial microwell. If you have access to a cell sorter (FACS), then apply selection pressure after transfection and collect the propidium iodide negative cells (adding Ethidium bromide 10mg/ml stock 1:10.000 might do it as well) for microplate seeding. This probably makes things much easier, especially when you get a low transfection rate. Good luck! Wo From metugenetics from yahoo.com Sun Jan 20 14:11:10 2008 From: metugenetics from yahoo.com (Ozan Aygun) Date: Sun Jan 20 17:10:28 2008 Subject: Stable transfection in suspension cells Message-ID: <681077.76249.qm@web90410.mail.mud.yahoo.com> Hi, This may depend on the suspension cell line that you are using. For example, although HeLa S3 cells grow in suspension they can be plated and transfected to form attached clones on plates. Once the clones are isolated, they can still grow in suspension. For your cells; first try to plate them and try to see whether they are attaching-although loosely they may attach enough to allow transfection- then try transfecting in plates. If your cell line does not allow this, then another alternative is using an IRES-GFP construct to express your gene/shRNA of interest. Alternatively you can cotransfect your construct with a pGFP vector, albeit this may bring some false positives. Once trasfected and selected one-two weeks in the selective medium then sort the GFP expressing cells by flow cytometry. This would give you a polyclonal but stable cell population. Alternatively, some people used IRES-cell surface marker construct to establish stable suspension cells. In this case stable cells co-express a well characterized heterogenous cell surface marker which allows you to use a specific antibody against this surface antigen coupled to magnetic beads. A couple of rounds of sepearation over a magnetic platform provides a stable cell population as well. If desired, this approach can be combined with drug selection to ensure the inhibition of the growth of any "spurious" cells. For details of these procedures please refer to some landmark chapters in Methods in Enzymology. I hope this may be of any help Good luck, Ozan ____________________________________________________________________________________ Looking for last minute shopping deals? Find them fast with Yahoo! Search. http://tools.search.yahoo.com/newsearch/category.php?category=shopping From analia_alet from intech.gov.ar Mon Jan 21 09:35:46 2008 From: analia_alet from intech.gov.ar (Analia Alet) Date: Mon Jan 21 12:07:42 2008 Subject: how to calculate Kcat value of enzyme In-Reply-To: <200801171705.m0HH5GL07592@net.bio.net> References: <200801171705.m0HH5GL07592@net.bio.net> Message-ID: <1200926146.4794adc2d58ca@webmail.intech.gov.ar> Hi, kcat = Vmax/Km, where Vmax could be expressed in mnol/(mg min) and Km in uM, so kcat is expressed in min-1 one good book explaining all this is Enzyme Kinetics: Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems (Wiley Classics Library)by Irwin H. Segel (Author) Best Regards Anal?a Good evening > molecular weight of enzyme is 60 kDa and I took 4 ug of it in each > reaction. Vmax and km values were obtained as 1.24 mmole/min/mg > protein and mM. so how could i calculate Kcat value of the enzyme ? > I will be very grateful for your kind cooperation. From your data you can first calcualte the molar amount of enzyme per reaction. Then re-express the velocity as mmole/min/mmole = 1/min, convert min to sec and you have the turnover number in 1/s = kat. If you have problems with any of that, ask your instructor to go through the calculation with you. From marker from rhrk.uni-kl.de Mon Jan 21 05:55:31 2008 From: marker from rhrk.uni-kl.de (Simone Marker) Date: Mon Jan 21 12:07:56 2008 Subject: loading RNA samples on denat. PAGE Message-ID: Hi, I have problems to get uniform bands when I load RNA samples on a denaturing polyacryle amide gel: My RNA samples are dissolved in formamide and my loading buffer is a standard buffer with formamide, EDTA and bromphenole blue. Running buffer is 0,5x TBE. I want to analyse samll RNA (23nt), so I have a 0,4mm thick 15% gel (like sequencing gels, denaturing agent is 7 M urea). I load 10 microlitres on the slots (its no problem to get uniform slots with adequate size). The problem is, that the samples (at least the bromphenole blue) diffuse into the gel bars between the slots immediatly after loading. Besides, when I start the run the single samples enter the gel in different ways, resulting in lanes of different width. After staining the gel I can still see different width of the lanes and bands, although the slots were uniform. Furthermore, the bands are not sharp enough. I run the gel at ca 1800-2000V (ca 50-60W) and 50°C. Does anyone have an idea how to improve the running quality? Thank you very much in advance, Simone From biotaniat from gmail.com Mon Jan 21 07:01:10 2008 From: biotaniat from gmail.com (biotc biotc) Date: Mon Jan 21 12:08:02 2008 Subject: kanamycin inactivation Message-ID: <9323dc540801210401i71a6a751gb694d358001af8ce@mail.gmail.com> Hi everyone Does anyone know if it is possible kanamycin be inactivated by a bacterial culture media like DM3 (agar;sodium succinate;casamino acids; yeast extract; K2PO4;KH2PO4;glucose;MgCl2 and BSA)? Can this be possible?? Thank you very much for your help bio From yvonne.couch from dpag.ox.ac.uk Mon Jan 21 03:40:41 2008 From: yvonne.couch from dpag.ox.ac.uk (Yvonne Couch) Date: Mon Jan 21 12:08:07 2008 Subject: Calculating Protein Concentration In-Reply-To: Message-ID: <001501c85c09$4e6852e0$2e7a01a3@dpag.ox.ac.uk> Hi guys, First off thanks to all who gave me help, much appreciated since nobody in the lab could help. Second of all if someone had told me to treat it like sodium chloride I too would have been able to do the maths. Finally I only graduated last year and it's not something I have ever had to do before and the spirit of unfriendliness which has greeted my question doesn't really prompt me to ask more, how do you expect people to learn the basics if they don't ask? And how are they meant to ask if all they're going to get is patronized? Y. -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of Terran Sent: 18 January 2008 22:08 To: methods@magpie.bio.indiana.edu Subject: Re: Calculating Protein Concentration I too thought this question seemed so silly, and to investigate the simplicity of the answer: I searched "Dalton definition" at www.google.com Looking for an .edu site I found: Dalton = measure of molecular weight or mass. One hydrogen atom has mass of 1 Da. Proteins and other macromolecule molecular weights are usually measured in kDa or kD (kilodaltons) - 1000 Da. From (http://www.biochem.northwestern.edu ) I didn't know the exact answer in the beginning, but from the definition it is a simple conversion problem. Freshmen with general chemistry could solve this. Simple laziness. ~Terran Graduate student Chemical and Biological Engineering Dept South Dakota School of Mines and Technology Rapid City, SD 57701 -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of WS Sent: Friday, January 18, 2008 12:45 PM To: methods@magpie.bio.indiana.edu Subject: Re: Calculating Protein Concentration Dear AK, seems that even at famous Oxford either the students or the teaching have become worse... Actually, this stuff is a sort of "first day, first lesson's knowledge" in almost any subject related to natural science. More to worry, a PhD (!) student in my lab asked me exactly the same question a few days ago, too. The funny thing is, when I told him to treat the problem the same way as to make a sodium chloride solution, he could solve the problem instantly. What makes me especially worry is that this kind of questions in this NG constantly seems to increase. I do not think it just lazyness, as for a newbie to find this NG on the web, usually, you need to have done some googling before on behalf of your actual problem. My impression is that many of those girls&guys really don't know how to solve their problems and somehow manage to discover the bionet. Hey students, please comment on this, your opinion and experience is wanted here!!! Did nobody teach you these things, do you not know where to find this kind of textbooks and lessens or are you really just lazy? Hey experts, is there any book/website/pdf/etc like {Mathematics, Chemistry, Logical Thinking, Statistics, Planning Experiments and Evaluating Experimental Data} in {Biochemistry, Molecular Biology, Life Science} for Dummies? Any ideas? Wo On 18 Jan., 18:40, "AK" wrote: > It is amazing to me that this basic question was honored here, perhaps since > she is from Oxford. I remember not too long ago a student was hammered to > death because of asking a basic question of plant extraction. UNFAIR. > AK _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods From stewjw from gmail.com Mon Jan 21 04:04:43 2008 From: stewjw from gmail.com (StewJW) Date: Mon Jan 21 12:08:12 2008 Subject: Calculating Protein Concentration References: Message-ID: Its a forum and so it shouldn't matter how basic is the question. Often its only when you start applying material you've learnt as an undergrad. that you begin to understand it. From stewjw from gmail.com Mon Jan 21 04:08:26 2008 From: stewjw from gmail.com (StewJW) Date: Mon Jan 21 12:08:17 2008 Subject: Calculating Protein Concentration References: Message-ID: <90c8fbeb-fd01-4b47-b3b9-5c7e85ab5713@e25g2000prg.googlegroups.com> I should add, I've known a lot of Biologists who still have difficulty understanding the concept of the mole very late in their careers. From acuzange from polyplus-transfection.com Mon Jan 21 13:57:28 2008 From: acuzange from polyplus-transfection.com (Alain CUZANGE) Date: Mon Jan 21 20:41:32 2008 Subject: Transfecting IMR90 cells References: <-2556763346104329530@unknownmsgid> Message-ID: <8EF3B568892C4F4D8C0B975D5557CF5FC91661@srvburnav.polyplus-trans fection.local> Hi Tim, As far as I know it is not a very difficult cell line. If you go to the Invitrogen link http://www.invitrogen.com/content.cfm?pageID=9559&fuseaction=CellLines.dsp_applicationDataDetails&applicationDataID=1601 you will find a brief protocol with LipoFectamin but definitely I recommend LipoFECTAMIN 2000 for those cells. Concerning CaPO4, it is a boring and not so reproductive method. A good alternative is to use jetPEI (a polymer based product). The protocol is faster than LipoFectamine 2000 (you can transfect in presence of serum and antibiotics, no need to change the medium). JetPEI is also less toxic at confluency between 50 to 70%. Good luck Alain -----Message d'origine----- De?: Tim Eggleston [mailto:timegg113@gmail.com] Envoy??: mardi 15 janvier 2008 21:32 ??: Alain CUZANGE Cc?: methods@magpie.bio.indiana.edu Objet?: Re: Transfecting IMR90 cells I would like to transfect DNA. Thank you for your help. Tim On Jan 15, 2008 10:55 AM, Alain CUZANGE wrote: > Hi Tim > Would you like to transfect DNA or siRNA? > Alain > acuzange@polyplus-transfection.com > > -----Message d'origine----- > De: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] De la part de Tim Eggleston > Envoy?: mardi 15 janvier 2008 17:37 > ?: methods@magpie.bio.indiana.edu > Objet: Transfecting IMR90 cells > > > I was wondering if anyone has attempted to transfect IMR90 fibroblast > cells using a Lipofectamine or calcium phosphate transfection. If so, > how well did it work? Thanks. > > Tim Eggleston > > -- > Tim Eggleston > Horne Lab > Research Assistant > 2-505 Bowen Science Building > University of Iowa > > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Tim Eggleston Horne Lab Research Assistant 2-505 Bowen Science Building University of Iowa From pow.joshi from gmail.com Mon Jan 21 13:01:56 2008 From: pow.joshi from gmail.com (Pow Joshi) Date: Mon Jan 21 20:41:41 2008 Subject: Calculating Protein Concentration In-Reply-To: References: Message-ID: <710764ea0801211001p295c099fo4b9a0268f4c2fbb4@mail.gmail.com> On 21/01/2008, StewJW wrote: > > Its a forum and so it shouldn't matter how basic is the question. > Often its only when you start applying material you've learnt as an > undergrad. that you begin to understand it. however, it is a matter of common sense to do exactly that .... _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > From R.Jayakumar from roswellpark.org Mon Jan 21 13:19:18 2008 From: R.Jayakumar from roswellpark.org (Jayakumar, R) Date: Mon Jan 21 20:41:47 2008 Subject: Calculating Protein Concentration In-Reply-To: <001501c85c09$4e6852e0$2e7a01a3@dpag.ox.ac.uk> References: <001501c85c09$4e6852e0$2e7a01a3@dpag.ox.ac.uk> Message-ID: <97101976F8A044468CA74FE11883B90E173E79A1@VISTA.roswellpark.org> Dear Yvonne Firstly, congratulations on your graduation. Secondly, dont take the advice given by members of this forum in a negative manner. If it was asked by someone from some mediocre university in some dark corner of the world with limited resources, people in this forum would have jumped head over heels to help without criticisms. But when somebody from a prestigious institute like Oxford asks that, that raises eyebrows. The ability to ask questions however embarassing they might be and take the answer (sometimes flavored with criticism) in a positive manner and in the spirit of learning is the hallmark of a successful scientist. YOu have got the first part right, but not the second part. We have all received our share of bricks and bats, but we have come out better for that. So what else did we learn here? In science, the questions you ask and the ways you adopt to solve those questions will contribute to your scientific persona. The criticisms AND help you have received reflects the open and broadminded approach frequently adopted by the esteemed members of this forum. Please dont let it discourage you from asking more questions. I have been a member of this forum for more than a decade (since my graduate studies) and I have received bricks as well as flowers and I have found both extremely useful in improving my outlook, knowledge and career. So dont get discouraged. EVeryone has asked such questions once in a while. Let it go. Finally you could not have solved the question by treating it like Sodium chloride unless otherwise you had known the relation between dalton, carbon's molar mass and mole. Jay -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of Yvonne Couch Sent: Monday, January 21, 2008 3:41 AM To: methods@magpie.bio.indiana.edu Subject: RE: Calculating Protein Concentration Hi guys, First off thanks to all who gave me help, much appreciated since nobody in the lab could help. Second of all if someone had told me to treat it like sodium chloride I too would have been able to do the maths. Finally I only graduated last year and it's not something I have ever had to do before and the spirit of unfriendliness which has greeted my question doesn't really prompt me to ask more, how do you expect people to learn the basics if they don't ask? And how are they meant to ask if all they're going to get is patronized? Y. -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of Terran Sent: 18 January 2008 22:08 To: methods@magpie.bio.indiana.edu Subject: Re: Calculating Protein Concentration I too thought this question seemed so silly, and to investigate the simplicity of the answer: I searched "Dalton definition" at www.google.com Looking for an .edu site I found: Dalton = measure of molecular weight or mass. One hydrogen atom has mass of 1 Da. Proteins and other macromolecule molecular weights are usually measured in kDa or kD (kilodaltons) - 1000 Da. From (http://www.biochem.northwestern.edu ) I didn't know the exact answer in the beginning, but from the definition it is a simple conversion problem. Freshmen with general chemistry could solve this. Simple laziness. ~Terran Graduate student Chemical and Biological Engineering Dept South Dakota School of Mines and Technology Rapid City, SD 57701 -----Original Message----- From: methods-bounces@oat.bio.indiana.edu [mailto:methods-bounces@oat.bio.indiana.edu] On Behalf Of WS Sent: Friday, January 18, 2008 12:45 PM To: methods@magpie.bio.indiana.edu Subject: Re: Calculating Protein Concentration Dear AK, seems that even at famous Oxford either the students or the teaching have become worse... Actually, this stuff is a sort of "first day, first lesson's knowledge" in almost any subject related to natural science. More to worry, a PhD (!) student in my lab asked me exactly the same question a few days ago, too. The funny thing is, when I told him to treat the problem the same way as to make a sodium chloride solution, he could solve the problem instantly. What makes me especially worry is that this kind of questions in this NG constantly seems to increase. I do not think it just lazyness, as for a newbie to find this NG on the web, usually, you need to have done some googling before on behalf of your actual problem. My impression is that many of those girls&guys really don't know how to solve their problems and somehow manage to discover the bionet. Hey students, please comment on this, your opinion and experience is wanted here!!! Did nobody teach you these things, do you not know where to find this kind of textbooks and lessens or are you really just lazy? Hey experts, is there any book/website/pdf/etc like {Mathematics, Chemistry, Logical Thinking, Statistics, Planning Experiments and Evaluating Experimental Data} in {Biochemistry, Molecular Biology, Life Science} for Dummies? Any ideas? Wo On 18 Jan., 18:40, "AK" wrote: > It is amazing to me that this basic question was honored here, perhaps since > she is from Oxford. I remember not too long ago a student was hammered > to > death because of asking a basic question of plant extraction. UNFAIR. > AK _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods _______________________________________________ Methods mailing list Methods@net.bio.net http://www.bio.net/biomail/listinfo/methods This email message may contain legally privileged and/or confidential information. If you are not the intended recipient(s), or the employee or agent responsible for the delivery of this message to the intended recipient(s), you are hereby notified that any disclosure, copying, distribution, or use of this email message is prohibited. If you have received this message in error, please notify the sender immediately by e-mail and delete this email message from your computer. Thank you. From stewjw from gmail.com Mon Jan 21 14:27:08 2008 From: stewjw from gmail.com (StewJW) Date: Mon Jan 21 20:41:54 2008 Subject: Calculating Protein Concentration References: Message-ID: Its all part of the game, you'll encounter far worse criticism when it comes to defending your research or when applying for grants. I'm sure the responses will help others as well. From ana-irda_ from hotmail.com Mon Jan 21 16:03:09 2008 From: ana-irda_ from hotmail.com (ana) Date: Tue Jan 22 12:24:49 2008 Subject: Immunostaining of mouse heart Message-ID: Hi! I have a problem here, I just started a project in my education and i need some help... If i want to stain a slide with heart tissue of a mouse what method should I use? I want to clearly see the small coronary vessels. If you have any good answers please help me out?! From ben.long from yourfinger.anu.edu.au Mon Jan 21 20:36:06 2008 From: ben.long from yourfinger.anu.edu.au (Bean Long) Date: Tue Jan 22 12:25:01 2008 Subject: Calculating Protein Concentration In-Reply-To: References: Message-ID: <47954887$1@clarion.carno.net.au> Yvonne Couch wrote: > Hi guys, > First off thanks to all who gave me help, much appreciated since nobody in > the lab could help. The question, while apparently easy for many of to answer, was certainly one to ask if your colleagues couldn't help. What surprises me is that a group with, what, 4 or 5 psotdocs and an equal number of PhD students didn't have the answer!! Well done for asking Yvonne. Now you are armed with a little bit more info to pass on to others. Bean From novalidaddress from nurfuerspam.de Tue Jan 22 03:26:13 2008 From: novalidaddress from nurfuerspam.de (WS) Date: Tue Jan 22 12:25:06 2008 Subject: BSA in bacterial growth media? Message-ID: <6e258ffc-2101-4010-bc9f-d17a9a11023e@i72g2000hsd.googlegroups.com> just have read in the cuurent kanamycin thread that BSA can be included in bacterial media formulations. Not having known that, I wonder now if I could convert some very crude BSA into bacterial food. Any comments? Wo (having 1kg of almost black powder labeled BSA on the shelve, accidentally bought with the intention to use it for blocking westerns ...) From pow.joshi from gmail.com Mon Jan 21 22:35:56 2008 From: pow.joshi from gmail.com (Pow Joshi) Date: Tue Jan 22 12:25:11 2008 Subject: Calculating Protein Concentration In-Reply-To: References: Message-ID: <710764ea0801211935s4db86c08x60ede24d8b068cdf@mail.gmail.com> On 21/01/2008, DK wrote: > > In article , "Yvonne > Couch" wrote: > >Hi guys, > >First off thanks to all who gave me help, much appreciated since nobody > in > >the lab could help. Second of all if someone had told me to treat it > like > >sodium chloride I too would have been able to do the maths. Finally I > only > >graduated last year and it's not something I have ever had to do before > and > >the spirit of unfriendliness which has greeted my question doesn't really > >prompt me to ask more, how do you expect people to learn the basics if > they > >don't ask? > > Yvonne, > > Please don't feel offended and understand that there was NOTHING > personal in numerous replies to your question!!! > > The "unfriendly" replies were not directed to you but, rather, were > intended to highlight pathetic state of education in modern > science, biology in particular. > > That you say that no one in the lab could help you > is MIND BOGGLING. Quite seriously - this is a stuff from > high school chemistry!!! In ideal world, anyone who managed > to not completely understand it must be expelled from any > college! Simply because it is an equivalent of mathematics > major having troubles with - uh, I don't know - short integral? > - multiplication table? > > That you apparently had bad teachers who allowed you > to successfully go through things that require this knowledge > without acquiring it is most certainly not your problem and > I don't think any single reply said that. It's a tragedy of many > modern societies. And I am afraid we will be paying dearly > for it down the road. Dumbing down higher education is > one of the shortest ways to a societal suicide. > > I believe your previous posts in this group that dealt with > common lab troubleshooting and protocols have never > elicited responses that you now call unfriendly. The reason > is very simple - they were "normal". Your latest question > was anything but normal, so it should come as no surprise > that the responses were "abnormal", too. ..I wholeheartedly agree wih DK..... xcept that I would also say that it is never too late to begin doing exactly what "StewJW" suggested about "applying ones knowledge" ...and that is surely independent of the teachers, is dependent on ones own understanding .... Please, this is not meant to be patronizing, just a simple suggestion that common snse goes a long way... imagine if we were to be re-learning the same things again and again and yet again .... boy, would it be one boring learning cycle ;) .... ...and this is a general comment: I one also sees very clearly, that science is , as again someone has already suggested, fast becoming a game of numbers and rote "doing" rather than anything to do with any kind of thought process or intellect that gives rise to hypothesis and predictions.... it is as well that one invented robots to do ones bidding (which may, very well, replace the numerous postdocs and technicians that the universities and industries employ) ... it is the age of "brute force" I suppose.... Pow DK > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > From sudhee26 from gmail.com Mon Jan 21 22:56:16 2008 From: sudhee26 from gmail.com (Sudheendra Rao N R) Date: Tue Jan 22 12:25:16 2008 Subject: Calculating Protein Concentration In-Reply-To: References: Message-ID: To be perfect is not to know things..but to do things as if you dont know.. On Jan 22, 2008 6:20 AM, DK wrote: > In article , "Yvonne > Couch" wrote: > >Hi guys, > >First off thanks to all who gave me help, much appreciated since nobody > in > >the lab could help. Second of all if someone had told me to treat it > like > >sodium chloride I too would have been able to do the maths. Finally I > only > >graduated last year and it's not something I have ever had to do before > and > >the spirit of unfriendliness which has greeted my question doesn't really > >prompt me to ask more, how do you expect people to learn the basics if > they > >don't ask? > > Yvonne, > > Please don't feel offended and understand that there was NOTHING > personal in numerous replies to your question!!! > > The "unfriendly" replies were not directed to you but, rather, were > intended to highlight pathetic state of education in modern > science, biology in particular. > > That you say that no one in the lab could help you > is MIND BOGGLING. Quite seriously - this is a stuff from > high school chemistry!!! In ideal world, anyone who managed > to not completely understand it must be expelled from any > college! Simply because it is an equivalent of mathematics > major having troubles with - uh, I don't know - short integral? > - multiplication table? > > That you apparently had bad teachers who allowed you > to successfully go through things that require this knowledge > without acquiring it is most certainly not your problem and > I don't think any single reply said that. It's a tragedy of many > modern societies. And I am afraid we will be paying dearly > for it down the road. Dumbing down higher education is > one of the shortest ways to a societal suicide. > > I believe your previous posts in this group that dealt with > common lab troubleshooting and protocols have never > elicited responses that you now call unfriendly. The reason > is very simple - they were "normal". Your latest question > was anything but normal, so it should come as no surprise > that the responses were "abnormal", too. > > DK > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Think before agree Think before you nod but STOP thinking and You Are God From ucgatan from ucl.ac.uk Tue Jan 22 09:31:40 2008 From: ucgatan from ucl.ac.uk (Tom Anderson) Date: Tue Jan 22 12:25:21 2008 Subject: Calculating Protein Concentration In-Reply-To: <97101976F8A044468CA74FE11883B90E173E79A1@VISTA.roswellpark.org> References: <001501c85c09$4e6852e0$2e7a01a3@dpag.ox.ac.uk> <97101976F8A044468CA74FE11883B90E173E79A1@VISTA.roswellpark.org> Message-ID: On Mon, 21 Jan 2008, Jayakumar, R wrote: > Finally you could not have solved the question by treating it like > Sodium chloride unless otherwise you had known the relation between > dalton, carbon's molar mass and mole. Where does carbon's molar mass come into it? tom -- Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E 6BT (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) thomas.anderson@ucl.ac.uk From k.vd.wetering from nki.nl Tue Jan 22 11:06:06 2008 From: k.vd.wetering from nki.nl (| |Koen) Date: Tue Jan 22 12:25:26 2008 Subject: gateway system Message-ID: <3ba47416-21de-46a3-a220-31222b988734@q39g2000hsf.googlegroups.com> Dear all, I want to use the gateway system of invitrogen to minimize the workload of subcloning our cDNAs in various expression vectors. Before using the system I have to clone our cDNAs in an appropriate pEntr vector. I used pEntr1a for this but I do not get any colonies on kanamycin plates using homemade DH5alpha or Invitrogen Top10 cells. I did remove the ccdB sequence before putting in our cDNA. I also tested cutting out the ccdB sequence, religating the empty vector and transforming bacteria with this. I get only a very limited amount of colonies from transformed Top10 cells and none on our own competent DH5alpha. can anyone tell me what I did wrong? Koen From ucgatan from ucl.ac.uk Tue Jan 22 13:19:50 2008 From: ucgatan from ucl.ac.uk (Tom Anderson) Date: Tue Jan 22 14:20:16 2008 Subject: Calculating Protein Concentration In-Reply-To: <710764ea0801211935s4db86c08x60ede24d8b068cdf@mail.gmail.com> References: <710764ea0801211935s4db86c08x60ede24d8b068cdf@mail.gmail.com> Message-ID: On Mon, 21 Jan 2008, Pow Joshi wrote: > On 21/01/2008, DK wrote: > > > That you apparently had bad teachers who allowed you to successfully > > go through things that require this knowledge without acquiring it is > > most certainly not your problem and I don't think any single reply > > said that. It's a tragedy of many modern societies. And I am afraid we > > will be paying dearly for it down the road. Dumbing down higher > > education is one of the shortest ways to a societal suicide. > > ...and this is a general comment: I one also sees very clearly, that > science is , as again someone has already suggested, fast becoming a > game of numbers and rote "doing" rather than anything to do with any > kind of thought process or intellect that gives rise to hypothesis and > predictions.... it is as well that one invented robots to do ones > bidding (which may, very well, replace the numerous postdocs and > technicians that the universities and industries employ) ... it is the > age of "brute force" I suppose.... I hear this a lot. The funny thing is, it doesn't correspond in the slightest to the way i, a graduate student, do science, or the way i see anyone else around me, student or postdoc, doing science. Yes, we use kits, and i doubt many people could tell you exactly what buffer QC does, but i can assure you we're fully engaged on the problems we work on. Not having to think about how DNA binds to a column doesn't mean we do less thinking, just that we have to spend more time thinking about the other problems we face. So, what's going on here? Is it the case that science is descending into rote doing or not? Is this just a standard complaint of grumpy old scientists? Have i been lucky to work in more switched-on environments? Is this something that's common in, say, biochemistry, or structural biology, or molecular biology labs, but less so in cell biology, where i work? Could it perhaps be a difference in culture between the US (where i think a lot of you are, although i'm not sure) and the UK (where i am)? It would be grimly ironic if it was the latter. Group leaders here are constantly urging us larvae to postdoc in the US, to learn the 'American style of doing science', implying it's some master secret that will unlock successful careers. Perhaps it's the exact opposite. I should say, though, that i don't think that's the case; British people i know who've worked in US labs generally report that there is no significant difference in culture (modulo the average size of labs, which is much bigger in the US). I suspect it's a weird cargo cult that's taken hold amongst British group leaders: all of them went to the US to postdoc, and now they're successful, so of course if we do it, we will be too, right? This displays a woeful lack of logic and understanding of cause and effect, but hey, this is group leaders we're talking about, no news there. tom -- Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E 6BT (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) thomas.anderson@ucl.ac.uk From pow.joshi from gmail.com Tue Jan 22 15:38:33 2008 From: pow.joshi from gmail.com (Pow Joshi) Date: Tue Jan 22 18:23:26 2008 Subject: Calculating Protein Concentration In-Reply-To: References: <001501c85c09$4e6852e0$2e7a01a3@dpag.ox.ac.uk> <97101976F8A044468CA74FE11883B90E173E79A1@VISTA.roswellpark.org> Message-ID: <710764ea0801221238x10b70526hff6a278c1144e32f@mail.gmail.com> On 22/01/2008, Tom Anderson wrote: > > On Mon, 21 Jan 2008, Jayakumar, R wrote: > > > Finally you could not have solved the question by treating it like > > Sodium chloride unless otherwise you had known the relation between > > dalton, carbon's molar mass and mole. > > Where does carbon's molar mass come into it? ...because, one Dalton is defined as 1/12th the mass of carbon-12.... This, too, is basic chemistry... Pow tom > > -- > Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E > 6BT > (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) > thomas.anderson@ucl.ac.uk > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > From pow.joshi from gmail.com Tue Jan 22 15:54:33 2008 From: pow.joshi from gmail.com (Pow Joshi) Date: Tue Jan 22 18:23:34 2008 Subject: Calculating Protein Concentration In-Reply-To: References: <710764ea0801211935s4db86c08x60ede24d8b068cdf@mail.gmail.com> Message-ID: <710764ea0801221254j1cc14490p1405e080f11bdc96@mail.gmail.com> On 22/01/2008, Tom Anderson wrote: > > On Mon, 21 Jan 2008, Pow Joshi wrote: > > > On 21/01/2008, DK wrote: > > > > > That you apparently had bad teachers who allowed you to successfully > > > go through things that require this knowledge without acquiring it is > > > most certainly not your problem and I don't think any single reply > > > said that. It's a tragedy of many modern societies. And I am afraid we > > > will be paying dearly for it down the road. Dumbing down higher > > > education is one of the shortest ways to a societal suicide. > > > > ...and this is a general comment: I one also sees very clearly, that > > science is , as again someone has already suggested, fast becoming a > > game of numbers and rote "doing" rather than anything to do with any > > kind of thought process or intellect that gives rise to hypothesis and > > predictions.... it is as well that one invented robots to do ones > > bidding (which may, very well, replace the numerous postdocs and > > technicians that the universities and industries employ) ... it is the > > age of "brute force" I suppose.... > > I hear this a lot. The funny thing is, it doesn't correspond in the > slightest to the way i, a graduate student, do science, or the way i see > anyone else around me, student or postdoc, doing science. Yes, we use > kits, and i doubt many people could tell you exactly what buffer QC does, > but i can assure you we're fully engaged on the problems we work on. Not > having to think about how DNA binds to a column doesn't mean we do less > thinking, just that we have to spend more time thinking about the other > problems we face. So, what's going on here? Is it the case that science is descending into > rote doing or not? Is this just a standard complaint of grumpy old > scientists? Have i been lucky to work in more switched-on environments? Is > this something that's common in, say, biochemistry, or structural biology, > or molecular biology labs, but less so in cell biology, where i work? > Could it perhaps be a difference in culture between the US (where i think > a lot of you are, although i'm not sure) and the UK (where i am)? It would be grimly ironic if it was the latter. Group leaders here are > constantly urging us larvae to postdoc in the US, to learn the 'American > style of doing science', implying it's some master secret that will unlock > successful careers. Perhaps it's the exact opposite. > > I should say, though, that i don't think that's the case; British people i > know who've worked in US labs generally report that there is no > significant difference in culture (modulo the average size of labs, which > is much bigger in the US). I suspect it's a weird cargo cult that's taken > hold amongst British group leaders: all of them went to the US to postdoc, > and now they're successful, so of course if we do it, we will be too, > right? This displays a woeful lack of logic and understanding of cause > and effect, but hey, this is group leaders we're talking about, no news > there. ah, Tom, the silly little details of knowiing "how the DNA binds to a column" actually helps one understand and interpret the results , and ofcourse, troubleshoot ....and believe me, it is what constitutes "thinking" as well, not just the the wonderful wild trips of imagination which we all love to indulge in .........and no, I don't consider myself grumpy little scientist, please, my grad-schooling was not long ago for such luxuries ......and the again some of your and my british colleagues may beg to differ from your view of the wonderful side of the coin.... .... my comments were a homage to all the lovely literature that gets published, a lot of which is so unique that not even the good Mother Nature will ever reproduce it .... tom > > -- > Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E > 6BT > (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) > thomas.anderson@ucl.ac.uk > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > From sudhee26 from gmail.com Wed Jan 23 10:09:25 2008 From: sudhee26 from gmail.com (Sudheendra Rao N R) Date: Wed Jan 23 11:18:48 2008 Subject: Calculating Protein Concentration In-Reply-To: <710764ea0801221254j1cc14490p1405e080f11bdc96@mail.gmail.com> References: <710764ea0801211935s4db86c08x60ede24d8b068cdf@mail.gmail.com> <710764ea0801221254j1cc14490p1405e080f11bdc96@mail.gmail.com> Message-ID: great going :) i guess we all need little patience.. those who are wondering as to how did some people manage to pass need to accept that they have passed.. and those who are wondering why people are responding this way..need to get little numb.. regards. its a great forum Sudheendra. On Jan 23, 2008 2:24 AM, Pow Joshi wrote: > On 22/01/2008, Tom Anderson wrote: > > > > On Mon, 21 Jan 2008, Pow Joshi wrote: > > > > > On 21/01/2008, DK wrote: > > > > > > > That you apparently had bad teachers who allowed you to successfully > > > > go through things that require this knowledge without acquiring it > is > > > > most certainly not your problem and I don't think any single reply > > > > said that. It's a tragedy of many modern societies. And I am afraid > we > > > > will be paying dearly for it down the road. Dumbing down higher > > > > education is one of the shortest ways to a societal suicide. > > > > > > ...and this is a general comment: I one also sees very clearly, that > > > science is , as again someone has already suggested, fast becoming a > > > game of numbers and rote "doing" rather than anything to do with any > > > kind of thought process or intellect that gives rise to hypothesis and > > > predictions.... it is as well that one invented robots to do ones > > > bidding (which may, very well, replace the numerous postdocs and > > > technicians that the universities and industries employ) ... it is the > > > age of "brute force" I suppose.... > > > > I hear this a lot. The funny thing is, it doesn't correspond in the > > slightest to the way i, a graduate student, do science, or the way i see > > anyone else around me, student or postdoc, doing science. Yes, we use > > kits, and i doubt many people could tell you exactly what buffer QC > does, > > but i can assure you we're fully engaged on the problems we work on. Not > > having to think about how DNA binds to a column doesn't mean we do less > > thinking, just that we have to spend more time thinking about the other > > problems we face. > > > > > So, what's going on here? Is it the case that science is descending into > > rote doing or not? Is this just a standard complaint of grumpy old > > scientists? Have i been lucky to work in more switched-on environments? > Is > > this something that's common in, say, biochemistry, or structural > biology, > > or molecular biology labs, but less so in cell biology, where i work? > > Could it perhaps be a difference in culture between the US (where i > think > > a lot of you are, although i'm not sure) and the UK (where i am)? > > > > > > It would be grimly ironic if it was the latter. Group leaders here are > > constantly urging us larvae to postdoc in the US, to learn the 'American > > style of doing science', implying it's some master secret that will > unlock > > successful careers. Perhaps it's the exact opposite. > > > > I should say, though, that i don't think that's the case; British people > i > > know who've worked in US labs generally report that there is no > > significant difference in culture (modulo the average size of labs, > which > > is much bigger in the US). I suspect it's a weird cargo cult that's > taken > > hold amongst British group leaders: all of them went to the US to > postdoc, > > and now they're successful, so of course if we do it, we will be too, > > right? This displays a woeful lack of logic and understanding of cause > > and effect, but hey, this is group leaders we're talking about, no news > > there. > > > > ah, Tom, the silly little details of knowiing "how the DNA binds to a > column" actually helps one understand and interpret the results , and > ofcourse, troubleshoot ....and believe me, it is what constitutes > "thinking" > as well, not just the the wonderful wild trips of imagination which we all > love to indulge in .........and no, I don't consider myself grumpy little > scientist, please, my grad-schooling was not long ago for such luxuries > ......and the again some of your and my british colleagues may beg to > differ > from your view of the wonderful side of the coin.... > .... my comments were a homage to all the lovely literature that gets > published, a lot of which is so unique that not even the good Mother > Nature > will ever reproduce it .... > > > > > tom > > > > -- > > Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London > WC1E > > 6BT > > (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) > > thomas.anderson@ucl.ac.uk > > > > _______________________________________________ > > Methods mailing list > > Methods@net.bio.net > > http://www.bio.net/biomail/listinfo/methods > > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/methods > -- Think before agree Think before you nod but STOP thinking and You Are God From leprevost from tecpar.br Tue Jan 22 21:29:47 2008 From: leprevost from tecpar.br (Felipe da Veiga Leprevost) Date: Wed Jan 23 11:18:56 2008 Subject: Gateway System Message-ID: <1a0d2f654c6f43aa50bf7c0a7a3c28e2@webmail.tecpar.br> Dear all, " I want to use the gateway system of invitrogen to = minimize the workload of subcloning our cDNAs in various expression = vectors. Before using the system I have to clone our cDNAs in an = appropriate pEntr vector. I used pEntr1a for this but I do not get any = colonies on kanamycin plates using homemade DH5alpha or Invitrogen = Top10 cells. I did remove the ccdB sequence before putting in our cDNA. = I also tested cutting out the ccdB sequence, religating the empty = vector and transforming bacteria with this. I get only a very limited = amount of colonies from transformed Top10 cells and none on our own = competent DH5alpha." Hi Koen, What protocol are you following to enter the plataform? = Are you making the BP reaction to clone your DNA into the entry vector? Leprevost From k.vd.wetering from nki.nl Wed Jan 23 12:16:24 2008 From: k.vd.wetering from nki.nl (| |Koen) Date: Wed Jan 23 15:12:36 2008 Subject: Gateway System References: Message-ID: <7f3dcc53-ce35-45ad-a6a3-0fa81e6a1ccc@e23g2000prf.googlegroups.com> Hi Felipe, no I am not using BP clonase to clone our gene of interest into the pEntr vector. Instead, I want to subclone it from another non Gateway construct that contains my gene of interest. Koen Felipe da Veiga Leprevost wrote: > Dear all, > " I want to use the gateway system of invitrogen to minimize the > workload of subcloning our cDNAs in various expression vectors. > Before > using the system I have to clone our cDNAs in an appropriate pEntr > vector. I used pEntr1a for this but I do not get any colonies on > kanamycin plates using homemade DH5alpha or Invitrogen Top10 cells. > I > did remove the ccdB sequence before putting in our cDNA. I also > tested > cutting out the ccdB sequence, religating the empty vector and > transforming bacteria with this. I get only a very limited amount of > colonies from transformed Top10 cells and none on our own competent > DH5alpha." > > Hi Koen, > What protocol are you following to enter the plataform? Are you > making the BP reaction to clone your DNA into the entry vector? > Leprevost From rmezencev3 from gatech.edu Wed Jan 23 13:55:00 2008 From: rmezencev3 from gatech.edu (Roman Mezencev) Date: Wed Jan 23 15:12:50 2008 Subject: Calculating protein concentration In-Reply-To: <200801231709.m0NH9BL01249@net.bio.net> References: <200801231709.m0NH9BL01249@net.bio.net> Message-ID: <1201114500.47978d848cbe7@webmail.mail.gatech.edu> In my view this discussion starts to be a bit counterproductive. It probably belongs to a completely different forum. Also, blaming only teachers for that may be an oversimplification. It is a student's responsibility to make sure that s/he understands basic concepts before s/he applies to a college/university. It should be a teacher's responsibility to make sure that a student with such a lack of knowledge would not pass. I suggest that this forum adhere to its skope which is techniques in cellular/molecular biology and biochemistry. RM Quoting methods-request@oat.bio.indiana.edu: > Send Methods mailing list submissions to > methods@net.bio.net > > To subscribe or unsubscribe via the World Wide Web, visit > http://www.bio.net/biomail/listinfo/methods > or, via email, send a message with subject or body 'help' to > methods-request@net.bio.net > > You can reach the person managing the list at > methods-owner@net.bio.net > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Methods digest..." > > > Today's Topics: > > 1. Re: Calculating Protein Concentration (Pow Joshi) > 2. Re: Calculating Protein Concentration (DK) > 3. Re: gateway system (DK) > 4. Re: Calculating Protein Concentration (Sudheendra Rao N R) > 5. Re: Gateway System (Felipe da Veiga Leprevost) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Tue, 22 Jan 2008 15:54:33 -0500 > From: "Pow Joshi" > Subject: Re: Calculating Protein Concentration > To: "Tom Anderson" > Cc: methods@magpie.bio.indiana.edu > Message-ID: > <710764ea0801221254j1cc14490p1405e080f11bdc96@mail.gmail.com> > Content-Type: text/plain; charset=ISO-8859-1 > > On 22/01/2008, Tom Anderson wrote: > > > > On Mon, 21 Jan 2008, Pow Joshi wrote: > > > > > On 21/01/2008, DK wrote: > > > > > > > That you apparently had bad teachers who allowed you to successfully > > > > go through things that require this knowledge without acquiring it is > > > > most certainly not your problem and I don't think any single reply > > > > said that. It's a tragedy of many modern societies. And I am afraid we > > > > will be paying dearly for it down the road. Dumbing down higher > > > > education is one of the shortest ways to a societal suicide. > > > > > > ...and this is a general comment: I one also sees very clearly, that > > > science is , as again someone has already suggested, fast becoming a > > > game of numbers and rote "doing" rather than anything to do with any > > > kind of thought process or intellect that gives rise to hypothesis and > > > predictions.... it is as well that one invented robots to do ones > > > bidding (which may, very well, replace the numerous postdocs and > > > technicians that the universities and industries employ) ... it is the > > > age of "brute force" I suppose.... > > > > I hear this a lot. The funny thing is, it doesn't correspond in the > > slightest to the way i, a graduate student, do science, or the way i see > > anyone else around me, student or postdoc, doing science. Yes, we use > > kits, and i doubt many people could tell you exactly what buffer QC does, > > but i can assure you we're fully engaged on the problems we work on. Not > > having to think about how DNA binds to a column doesn't mean we do less > > thinking, just that we have to spend more time thinking about the other > > problems we face. > > > > > So, what's going on here? Is it the case that science is descending into > > rote doing or not? Is this just a standard complaint of grumpy old > > scientists? Have i been lucky to work in more switched-on environments? Is > > this something that's common in, say, biochemistry, or structural biology, > > or molecular biology labs, but less so in cell biology, where i work? > > Could it perhaps be a difference in culture between the US (where i think > > a lot of you are, although i'm not sure) and the UK (where i am)? > > > > > > It would be grimly ironic if it was the latter. Group leaders here are > > constantly urging us larvae to postdoc in the US, to learn the 'American > > style of doing science', implying it's some master secret that will unlock > > successful careers. Perhaps it's the exact opposite. > > > > I should say, though, that i don't think that's the case; British people i > > know who've worked in US labs generally report that there is no > > significant difference in culture (modulo the average size of labs, which > > is much bigger in the US). I suspect it's a weird cargo cult that's taken > > hold amongst British group leaders: all of them went to the US to postdoc, > > and now they're successful, so of course if we do it, we will be too, > > right? This displays a woeful lack of logic and understanding of cause > > and effect, but hey, this is group leaders we're talking about, no news > > there. > > > > ah, Tom, the silly little details of knowiing "how the DNA binds to a > column" actually helps one understand and interpret the results , and > ofcourse, troubleshoot ....and believe me, it is what constitutes "thinking" > as well, not just the the wonderful wild trips of imagination which we all > love to indulge in .........and no, I don't consider myself grumpy little > scientist, please, my grad-schooling was not long ago for such luxuries > ......and the again some of your and my british colleagues may beg to differ > from your view of the wonderful side of the coin.... > .... my comments were a homage to all the lovely literature that gets > published, a lot of which is so unique that not even the good Mother Nature > will ever reproduce it .... > > > > > tom > > > > -- > > Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London WC1E > > 6BT > > (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) > > thomas.anderson@ucl.ac.uk > > > > _______________________________________________ > > Methods mailing list > > Methods@net.bio.net > > http://www.bio.net/biomail/listinfo/methods > > > > > ------------------------------ > > Message: 2 > Date: Wed, 23 Jan 2008 00:58:00 GMT > From: dk@no.email.thankstospam.net (DK) > Subject: Re: Calculating Protein Concentration > To: methods@net.bio.net > Message-ID: > > In article , Tom Anderson > wrote: > >On Mon, 21 Jan 2008, Pow Joshi wrote: > > > >> On 21/01/2008, DK wrote: > >> > >> > That you apparently had bad teachers who allowed you to successfully > >> > go through things that require this knowledge without acquiring it is > >> > most certainly not your problem and I don't think any single reply > >> > said that. It's a tragedy of many modern societies. And I am afraid we > >> > will be paying dearly for it down the road. Dumbing down higher > >> > education is one of the shortest ways to a societal suicide. > >> > >> ...and this is a general comment: I one also sees very clearly, that > >> science is , as again someone has already suggested, fast becoming a > >> game of numbers and rote "doing" rather than anything to do with any > >> kind of thought process or intellect that gives rise to hypothesis and > >> predictions.... it is as well that one invented robots to do ones > >> bidding (which may, very well, replace the numerous postdocs and > >> technicians that the universities and industries employ) ... it is the > >> age of "brute force" I suppose.... > > > >I hear this a lot. The funny thing is, it doesn't correspond in the > >slightest to the way i, a graduate student, do science, or the way i see > >anyone else around me, student or postdoc, doing science. > > When I came to the lab, everyone was religiously was dissolving > agarose in QG/QC at 55C, wasting precious time of the single > water bath. No one bothered to check what happens if one > 1) tries 37C, 2) tries 68C (for which there is a heating block > available). The answer - nothing happens, works exactly the > same way as 55C. Slower at 37, faster at 68. > > Further, even in the light of indisputable evidence that "Quik > solution" is DMSO, many were reluctant to use DMSO and > kept buying pointless because they could not buy "Quik > solution". > > Try asking why we have a stirring bar in dialysis or why > it is customary to flame flasks' and bottles' necks when > working with sterile cultures. Betcha few in your enlightened > environment know the answers - they just treat this stuff as > black boxes and protocols. (Resulting in absolutely ridiculous > behavior when, for example, flaming things). > > >Yes, we use > >kits, and i doubt many people could tell you exactly what buffer QC does, > > Guanidinium thiocyanate - a salt of two chaotropic ions. > PB, guanidinium hydrochloride, is not soluble at concentrations > needed to dissolve agarose. More chaotropic salt does it. > > >but i can assure you we're fully engaged on the problems we work on. Not > >having to think about how DNA binds to a column doesn't mean we do less > >thinking, just that we have to spend more time thinking about the other > >problems we face. > > Yeah, except when one loses DNA and has no idea what happened. > Or when one faces situation that cannot be circumvented by buying > yet another kit. > > >So, what's going on here? Is it the case that science is descending into > >rote doing or not? Is this just a standard complaint of grumpy old > >scientists? Have i been lucky to work in more switched-on environments? Is > >this something that's common in, say, biochemistry, or structural biology, > >or molecular biology labs, but less so in cell biology, where i work? > > Cell biology, where I used to work, is absolutely the worst in this > respect! (And most bullshit published, BTW; e.g. "colocalization" > pics that show ~ entire cytoplasm stained with two colors; or > "binding" and "interaction" based on IPs where totals are > omitted to cover up the fact that barely anything is pulled down > and tiny slices of the gels are shown to disguise horribly > non-specific antibodies). > > >Could it perhaps be a difference in culture between the US (where i think > >a lot of you are, although i'm not sure) and the UK (where i am)? > > Could be but don't forget where the original poster comes from. > > >It would be grimly ironic if it was the latter. Group leaders here are > >constantly urging us larvae to postdoc in the US, to learn the 'American > >style of doing science', implying it's some master secret that will unlock > >successful careers. Perhaps it's the exact opposite. > > > >I should say, though, that i don't think that's the case; British people i > >know who've worked in US labs generally report that there is no > >significant difference in culture (modulo the average size of labs, which > >is much bigger in the US). > > No difference in culture but an appreciable difference in education > system. May still be a factor. > > > suspect it's a weird cargo cult that's taken > >hold amongst British group leaders: all of them went to the US to postdoc, > >and now they're successful, so of course if we do it, we will be too, > >right? This displays a woeful lack of logic and understanding of cause > >and effect, but hey, this is group leaders we're talking about, no news > >there. > > Now that the USA is, unfortunately, losing its status of world's > scientific leader (I remember reading couple years ago in Science > that European papers now have higher citation impact factor), > this too will pass. French used to come to the USA for postdoc > to boost their chances home; this is largely no longer the > case today. > > DK > > > ------------------------------ > > Message: 3 > Date: Wed, 23 Jan 2008 01:10:12 GMT > From: dk@no.email.thankstospam.net (DK) > Subject: Re: gateway system > To: methods@net.bio.net > Message-ID: > > In article > <3ba47416-21de-46a3-a220-31222b988734@q39g2000hsf.googlegroups.com>, "| > |Koen" wrote: > >Dear all, > > > >I want to use the gateway system of invitrogen to minimize the > >workload of subcloning our cDNAs in various expression vectors. > > Have you considered the fact that the cloning artifacts that it > inevitably reproduces (please correct me if I am wrong) may > skew your results significantly? > > I've seen more than one example of just a single "strange" > amino acid significantly affecting protein's properties. > > Before > >using the system I have to clone our cDNAs in an appropriate pEntr > >vector. I used pEntr1a for this but I do not get any colonies on > >kanamycin plates using homemade DH5alpha or Invitrogen Top10 cells. I > >did remove the ccdB sequence before putting in our cDNA. I also tested > >cutting out the ccdB sequence, religating the empty vector and > >transforming bacteria with this. I get only a very limited amount of > >colonies from transformed Top10 cells and none on our own competent > >DH5alpha. > > > >can anyone tell me what I did wrong? > > So, if I understand correctly, you are not getting ligation for cloning > into pEntry clone to work? Is this right? If yes, then, unfortunately, > there is almost an endless list of possibilities and, unless you have > done all the usual ligation troubleshooting controls and can list > them, there is no way for others to know what went wrong. > > If you are talking about recombination from pEntry into > other vectors not working then, since this would be using a kit for > which very little concrete information is available, it's hard to tell > where problems are. The simplest is that you have dirty miniprep > that carries over some inhibitors into the reaction. Try cleaning > up your vector. > > DK > > > ------------------------------ > > Message: 4 > Date: Wed, 23 Jan 2008 20:39:25 +0530 > From: "Sudheendra Rao N R" > Subject: Re: Calculating Protein Concentration > To: "Pow Joshi" , methods > > Message-ID: > > Content-Type: text/plain; charset=ISO-8859-1 > > great going :) > i guess we all need little patience.. > those who are wondering as to how did some people manage to pass need to > accept that they have passed.. > and those who are wondering why people are responding this way..need to get > little numb.. > > regards. > its a great forum > > Sudheendra. > > On Jan 23, 2008 2:24 AM, Pow Joshi wrote: > > > On 22/01/2008, Tom Anderson wrote: > > > > > > On Mon, 21 Jan 2008, Pow Joshi wrote: > > > > > > > On 21/01/2008, DK wrote: > > > > > > > > > That you apparently had bad teachers who allowed you to successfully > > > > > go through things that require this knowledge without acquiring it > > is > > > > > most certainly not your problem and I don't think any single reply > > > > > said that. It's a tragedy of many modern societies. And I am afraid > > we > > > > > will be paying dearly for it down the road. Dumbing down higher > > > > > education is one of the shortest ways to a societal suicide. > > > > > > > > ...and this is a general comment: I one also sees very clearly, that > > > > science is , as again someone has already suggested, fast becoming a > > > > game of numbers and rote "doing" rather than anything to do with any > > > > kind of thought process or intellect that gives rise to hypothesis and > > > > predictions.... it is as well that one invented robots to do ones > > > > bidding (which may, very well, replace the numerous postdocs and > > > > technicians that the universities and industries employ) ... it is the > > > > age of "brute force" I suppose.... > > > > > > I hear this a lot. The funny thing is, it doesn't correspond in the > > > slightest to the way i, a graduate student, do science, or the way i see > > > anyone else around me, student or postdoc, doing science. Yes, we use > > > kits, and i doubt many people could tell you exactly what buffer QC > > does, > > > but i can assure you we're fully engaged on the problems we work on. Not > > > having to think about how DNA binds to a column doesn't mean we do less > > > thinking, just that we have to spend more time thinking about the other > > > problems we face. > > > > > > > > > > So, what's going on here? Is it the case that science is descending into > > > rote doing or not? Is this just a standard complaint of grumpy old > > > scientists? Have i been lucky to work in more switched-on environments? > > Is > > > this something that's common in, say, biochemistry, or structural > > biology, > > > or molecular biology labs, but less so in cell biology, where i work? > > > Could it perhaps be a difference in culture between the US (where i > > think > > > a lot of you are, although i'm not sure) and the UK (where i am)? > > > > > > > > > > > > It would be grimly ironic if it was the latter. Group leaders here are > > > constantly urging us larvae to postdoc in the US, to learn the 'American > > > style of doing science', implying it's some master secret that will > > unlock > > > successful careers. Perhaps it's the exact opposite. > > > > > > I should say, though, that i don't think that's the case; British people > > i > > > know who've worked in US labs generally report that there is no > > > significant difference in culture (modulo the average size of labs, > > which > > > is much bigger in the US). I suspect it's a weird cargo cult that's > > taken > > > hold amongst British group leaders: all of them went to the US to > > postdoc, > > > and now they're successful, so of course if we do it, we will be too, > > > right? This displays a woeful lack of logic and understanding of cause > > > and effect, but hey, this is group leaders we're talking about, no news > > > there. > > > > > > > > ah, Tom, the silly little details of knowiing "how the DNA binds to a > > column" actually helps one understand and interpret the results , and > > ofcourse, troubleshoot ....and believe me, it is what constitutes > > "thinking" > > as well, not just the the wonderful wild trips of imagination which we all > > love to indulge in .........and no, I don't consider myself grumpy little > > scientist, please, my grad-schooling was not long ago for such luxuries > > ......and the again some of your and my british colleagues may beg to > > differ > > from your view of the wonderful side of the coin.... > > .... my comments were a homage to all the lovely literature that gets > > published, a lot of which is so unique that not even the good Mother > > Nature > > will ever reproduce it .... > > > > > > > > > > tom > > > > > > -- > > > Tom Anderson, MRC Laboratory for Molecular Cell Biology, UCL, London > > WC1E > > > 6BT > > > (t) +44 (20) 76797264 (f) +44 (20) 76797805 (e) > > > thomas.anderson@ucl.ac.uk > > > > > > _______________________________________________ > > > Methods mailing list > > > Methods@net.bio.net > > > http://www.bio.net/biomail/listinfo/methods > > > > > _______________________________________________ > > Methods mailing list > > Methods@net.bio.net > > http://www.bio.net/biomail/listinfo/methods > > > > > > -- > Think before agree > Think before you nod > but STOP thinking > and You Are God > > > ------------------------------ > > Message: 5 > Date: Wed, 23 Jan 2008 00:29:47 -0200 > From: Felipe da Veiga Leprevost > Subject: Re: Gateway System > To: methods@magpie.bio.indiana.edu > Message-ID: <1a0d2f654c6f43aa50bf7c0a7a3c28e2@webmail.tecpar.br> > Content-Type: text/plain; charset="iso-8859-1" > > > Dear all, > " I want to use the gateway system of invitrogen to = minimize the > workload of subcloning our cDNAs in various expression = vectors. > Before > using the system I have to clone our cDNAs in an = appropriate pEntr > vector. I used pEntr1a for this but I do not get any = colonies on > kanamycin plates using homemade DH5alpha or Invitrogen = Top10 cells. > I > did remove the ccdB sequence before putting in our cDNA. = I also > tested > cutting out the ccdB sequence, religating the empty = vector and > transforming bacteria with this. I get only a very limited = amount of > colonies from transformed Top10 cells and none on our own = competent > DH5alpha." > > Hi Koen, > What protocol are you following to enter the plataform? = Are you > making the BP reaction to clone your DNA into the entry vector? > Leprevost > > > ------------------------------ > > _______________________________________________ > Methods mailing list > Methods@net.bio.net > http://www.bio.net/biomail/listinfo/metho