Cloning Problems shRNA

[Yvonne Couch]

Hi all,

I'm trying to make the Invitrogen U6 shRNA entry vector pENTR express an
shRNA with the following sense sequence

CACCGAAGTTAGGACACAGCATCGAAATGCTGTGTCCTAACTTC

And the following antisense sequence

AAAAGAAGTTAGGACACAGCATTTCGATGCTGTGTCCTAACTTC

Both are displayed as 5' and both have overhangs that fit into pENTR.  The
kit comes with instructions that suggest 1:10 molar ratio of vector to
insert.  This failed even to produce LacZ clones on the control plate.
Upping it to 1:3 bp ratio allowed us to see colonies on the LacZ plate but
nothing on the shRNA plate.  At the moment I'm using 2ng of vector and
0.12ng of insert but it's still not working.  Any ideas what could be going
wrong?

Cheers

Yvonne