method of choice to identify DNA bending, kinking or any other deformation?

[newera at plaza.snu.ac.kr]

I have a DNA binding protein(mw 6100), presumed to be a dimer and not to need any cofactors. It suppresses the replication of a certain gene by binding to its binding sequence overlaped by the promoter site of the gene. 
Its binding DNA sequence is much highly AT-rich and has two palindromic sites, each consisting of 9 base pairs. 12 base pairs exist between the palindromic sites.

--------     ..
TGTTTTTTATGTTAAAGTGAAAAAAACA
ACAAAAAATACAATTTCACTTTTTTTGT
                    --------

I have some questions in studying its protein-induced DNA defomation:

1. Does it have any possiblity of inducing DNA deformaiton?
2. What a handy method can elucidate whether it induces DNA deformation or not?

Gel retardation assay is under consideration although I think it is suitable for only indentification of DNA bending.

Could you advise me on this matter?

--
email 	: newera at plaza.snu.ac.kr
address :
  Lee, Ji Hyun
  Laboratory of Physical Pharmacy(Prof. Lee, Bong Jin)

  Seoul National University
  College of Pharmacy		  
  Shinlim-Dong, Kwanak-Gu
  Seoul 151-742, Korea.