PCR ribotyping with 16S-23S IGS

Kirsty Townsend kirsty.townsend at mailbox.uq.edu.au
Thu Jan 22 16:54:55 EST 1998


I have been trying unsuccessfully to perform PCR ribotyping on isolates
of Salmonella typhimurium and Pasteurella multocida by amplifying the
16S-23S intergenic spacer region. The primers I have been trying are
those used by Kostman et al (1992) J. Clin. Microbiol. 30:2084-2087 and
Nastasi et al (1997) J. Med. Micrbiol. 46:377-382. The sequences are as
follows:

5' - TTGTACACACCGCCCGTCA - 3'
5' - GGTACCTTAGATGTTTCAGTTC - 3'

So far, absolutely nothing has amplified, even when I follow the
published methods down to using the same brand of Taq. If anybody has
-any- ideas, please email me on kirsty.townsend at mailbox.uq.edu.au

Thanks,

Kirsty Townsend
Division of Veterinary Pathology and Anatomy
School of Veterinary Science and Animal Production
The University of Queensland
Brisbane 4072 AUSTRALIA

Ph: +61 7 3365 2667
Fax: +61 7 3365 1355



More information about the Microbio mailing list