HELP!!! - Calculation of oligo Tm for Streptomyces colony hybridisation
Kay Fowler
kay.fowler at bbsrc.ac.uk
Thu Nov 2 14:04:51 EST 2000
I desperately need help.
I have an oligo which I want to use in colony hybridisation of
Streptomyces, to pick out a specific mutant strain from a library. The
oligo has 100% homology with the expected target DNA, which will be
immobilised on either Hybond N membranes or Whatman 541 filters.
The sequence of the oligo (20-mer, 65% G+C) is:
TGGAGGAGGAGGGGGTTGAG
However, the two halves of the oligo (10 nucleotides each half) are each
expected to be homologous to another sequence. These sequences are
expected to be present in all the strains in the library, but not
immediately adjacent to each other, as is the case in the specific
mutant that I am trying to identify.
15 picomoles of oligo have been radiolabelled.
The problem I am having is in determining the hybridisation temperature,
using hybridisation buffer with 5X SSC, and then the stringency
(salt/temperature) of the subsequent washes. Obviously, this depends on
the Tm of the oligo, which depends on the salt concentration. I am
unsure how to go about determining these conditions.
Please, can someone help me.
Kay Fowler
kay.fowler at bbsrc.ac.uk
---
More information about the Microbio
mailing list