molecular clocks (long example)

Donald A. Lehn donnel at helix.nih.gov
Sat Sep 7 23:43:54 EST 1991


In article <9109070212.AA19281 at bambi.ccs.fau.edu> tomh at BAMBI.CCS.FAU.EDU
>
>I still wonder about totally neutral mutations.  What would be an example?
>How do we know a large proportion of bases are silent?

Actually, neutral mutations are quite common.  If we take a look at the
same gene from mice and men, we see that there are regions that are
virtually identical that are flanked by regions that are random.  The
regions that are identical include the coding regions of genes and their
respective promoter/enhancer regions.

For example, if we look at the 5' regions of the human and mouse HMG-14
genes  (capital letters represent regions of sequence that are 100%
homologous between the two species):

Human     ggatccccagcactttgggaggccgaggcgggaggatcgcttgagcccaggagtcggaga    60
Mouse     gaattccctgtcctaaatacaagttttatggtaggcaaagacatatatgataattcttac    60


Human     ccatgctgtgcaacatagtgaaaccccctctctacaaaaaatacaaaagttagctgggca   12
Mouse     aattgagcagcagtaatacggctgcgggtgggactcttgtacccagcccgctatctgcat   120


Human     aaatggtgccctgtggtcccagctactcgggaggccggagtgggaggttcgctggagccg   180
Mouse     tcttgaggtatactcaatattaactgccttccataaacaaaaggtgcaatctggaagtcg   180


Human     aaggggtcgaggctgcaatgagccgtgatcgcaccactgcactccagcctggacgacaca   240
Mouse     gagctagacccgacgccgctgcgcgaaggactgggtctgtaaagggccgatgtgattcct   240


Human     acgagaccctgtctcaaataaaaggaaggaaggaaggaagttacacagaaaggccgcgtc   300
Mouse     gcacacagttgaacacaggacggaggggtccatgcagtggggagggaagagccgagacag   300


Human     gcgtctccgtcccacgccctcctgcagcgcctgcgcaccaggcccgcttcacgcaggcct   360
Mouse     ctgcaagacctaaaacagacagacatagttacctaaaaataggctagtaaaggcgcgtag   360


Human     gcgaagctggagcccctggatagcctttcttgccgacagaggcgggagaaatttgctact   420
Mouse     gacagcctgagtctgcgcgaccggcccgcgcgcgcctgcgcactgctgctgcgcctgtcg   420


Human     tcctgtataccttatccttctcccttcccagtctaagatacgaactataaatgttcgaac   480
Mouse     ctcccgggcgaatggcaaatcacgcctaggcactgctgaacccgaggggtccgcgggtgg   480


Human     ccaattcaccccggagaggggccagataccagtggcctgaaggcgcccaggtatccagaa   540
Mouse     actccgccgggcgggcgcctggggtccggagcattgtgggaaagcgatgctgaggccacg   540


Human     gaattgtgggtggggacccgcggtcgtgacgtgcgtccgccaATCAGCGCGCAGaCCGCA   600
Mouse     tgacacgcccccactt--------------------------ATCAGCGCGCAGgCCGCA   574


Human     C-TTTGCgcTCGGCTTCAAACtAccgtgagccggagcgcactgggaccccgcccccttcg   659
Mouse     CtTTTGCtgTCGGCTTCAAACaAactacctagcggggtcgggcgactccggcccgcccct   634


Human     cctgggtctggggccccgcgagacggcggaaagGGGTGGGGGcgCccGGGGgGGcGgGAg   719
Mouse     cggccggggtcgcgcccgca-------------GGGTGGGGGgcCagGGGGcGGgGcGAt   681


Human     gggggcggggtgcgggatcGAGTGACgGCcCGCCtcaCCTATTCcGGgcgc-GGGCTGag   778
Mouse     gcggcg-------------GAGTGACaGCtCGCCgtgCCTATTCgGGagcaaGGGCTGgc   728


Human     tcccgt-------------------AGCCAATGGgcgggggtgGGGGGCGGCCCGGCcGG   819
Mouse     tggcgcgtacgcggtgggcctagacAGCCAATGGaggct----GGGGGCGGCCCGGCtGG   784


Human     CGGGGAGGgggagccgcggccgggaCGCgGGGGGagGAGGaGGCGGGCTCCcAATCCGGT   879
Mouse     CGGGGAGG-----------------CGC-GGGGGgaGAGGgGGCGGGCTCC-AATCCGGT   825


Human     TCCATCCGGTTCTCCCACCGCCCCCGCtgtGGGTCtCAGCAGcTCGggcggcgggaggag   939
Mouse     TCCATCCGGTTCTCCCACCGCCCCCGCgacGGGTCgCAGCAGtTCGtgtggtggtggcgg   885


Human     tggcagcggcaaggcagcccagtttcgcgaaggctgtcggcgcgccgcggcccgcaggca   999
Mouse     cggcggcttggcagtgcggctcctcggtgacagatccgaca-------------------   926


Human     cccggcacgcgccttccccgcaggcacccggcacgcgccttcccCGCCGCCACGATGCCC  1059
Mouse     ------------------------cgcacgcgtctcccaccccgCGCCGCCACGATGCCC   962


Human     AAGAGGAAGGTGAGcggcggccgcggcccgcacacgccccctggagccgccgccggcccc  1119
Mouse     AAGAGGAAGGTGAGtcggcggggccgcggcgccgcagggttcgggtctgaggggctctgg  1022


Human     cgccggccccgcgaggcccaggccccgttgcacccacggtggcgacgggcccgggaggcg  1179
Mouse     aatcttcgcggg------------------------------------------------  1034


Human     cttggagaccggcgggcgggcaggcgagcgctcggcggccgcgggggcggcgttctggaa  1239
Mouse     ------------------------------------------------------------  1034


Human     cgtttggcggccgggggagctgagggggctattcgaacGgGgcGGCGGgaaGcCGTGACG  1299
Mouse     --------------------------------------GtGcgGGCGGctgGgCGTGACG  1056


Human     TCACgcGGCCggGCATTGTTCTCggggccgggcgggcccgcgagtcctgggactgcggcc  1359
Mouse     TCACcgGGCC--GCATTGTTCTCcgctgtgctttct------------------------  1090


Human     cgcctctattcgtgcgtctccgtctcc---GCAGGTcAGCtccGCcGAaGGcGCCGCCAA  1416
Mouse     ---------------------------cctGCAGGTtAGC---GCgGAtGGaGCCGCCAA  1120


Human     GGaaGAGGTGAGTGCGGGcCtTCtGcgGGGggtggtgggtttcccgtgagccgctggcct  1476
Mouse     GGcgGAGGTGAGTGCGGGgCcTCgGgtGGGccgggcggatcggggcgggcggtggggtgc  1180


Human     gccttctcttctcgctgactctcctttttctttctccaAGCCCAAGaGgaGaTCgGCGcG  1536
Mouse     cgctcacatgcgctgctcacccg--tctttctctccgcAGCCCAAGcGccGcTCcGCGaG  1238


Human     GtTGTCaGCtGTAAGTAaaGCGagccccgtaaccgttcgttttccgcgggtcgtcccggg  1596
Mouse     GcTGTCgGCcGTAAGTAccGCGctcggtccgggccgggacgggagcgagcgggccgggcc  1299


We find in the two sequences long spans of apparently non-homologous sequences
(for example bases (human) 1-580) whith sequence similarity of <50% which flank
blocks of sequences with much greater (>90%) sequence similarity.  The sequences
that are identical represent the promoter elements and the coding regions of
the gene.  The non-similar regions correspond to flanking regions and non-
coding introns.  As you can see, the regions of DNA which code for the protein
are highly conserved and the other regions represent the totally silent
mutations that you were asking for an illustration of.  The sequence similarity
between human and mouse HMG-14 is typical.

Although you might be concerned about comparing mice and men, such comparisons
are the best way of determining what regions of DNA are important and that
are constrained in being able to be mutated.

>
>Tom Holroyd
>Center for Complex Systems
>Florida Atlantic University
>tomh at bambi.ccs.fau.edu


--
Donald A. Lehn, Ph.D.                      Phone: (301) 496-2885
Bldg.37 Rm 3D20                            FAX:   (301) 496-8419
National Cancer Institute / NIH            Email: donnel at helix.nih.gov
Bethesda MD 20892



More information about the Mol-evol mailing list