AIDS (hiv2)
Eric E. Snyder
eesnyder at boulder.Colorado.EDU
Wed Feb 12 22:51:28 EST 1992
robison1 at husc9.harvard.edu (Keith Robison) writes:
>In article <eesnyder.697915657 at beagle> eesnyder at boulder.Colorado.EDU (Eric E. Snyder) writes:
>>Just as _Drosophila_ P-elements appeared to have
>>arisen _de novo_ in the 1920s...
>I know that P-elements are believed to be of evolutionarily recent origin,
>but THAT recent? (references please)
Yes, they are very recent. I don't have the original papers handy
but a good start is Watson _et al._ _The Molecular Biology of the Gene_,
I think at the end of Ch 20. If I remember the papers on the subject
(ie. don't quote me), the presence of P-elements were assayed by squash
blot of _Drosophila_ strains isolated in various years from various
geographical localities. That hybridization was used as the assay
suggests that mobile P-elements were not just the activation of a
previously dormant transposable element but rather entered _Drosophila
melanogaster_ from outside the species.
The Watson text cites Kidwell, M. G. (1983) "Evolution of Hybrid Dysgenesis
Determinants in _Drosophila melanogaster_." PNAS 80:1655-1659.
Anyway, I think seeing this sort of genomic evolution occuring on a
human time scale is facinating. Can anyone think of other examples?
---------------------------------------------------------------------------
TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG
Eric E. Snyder
Department of MCD Biology ...making feet for childrens' shoes.
University of Colorado, Boulder
Boulder, Colorado 80309-0347
LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu
---------------------------------------------------------------------------
More information about the Mol-evol
mailing list