genetic code & mutation rates
Shane McKee
shane at reservoir.win-uk.net
Fri Aug 4 20:25:54 EST 1995
In article <EDDY.95Jul31071941 at wol.wustl.edu>,
Sean Eddy (eddy at wol.wustl.edu) writes:
>In article <3vauce$obv at newsbf02.news.aol.com> hpyockey at aol.com (HPYockey) writes:
> >Theoretical biology should follow theoretical physics.
>
>With respect, I couldn't disagree more.
>
>Theoretical physics has made such tremendous strides because, in
>physics, simplicity is truth. In biology, simplicity is rarely
>truth. Occam's razor need not apply to a biological system that has
>been mightily lifted from the ooze by three billion years of
>evolutionary tinkering.
I think a helpful way of looking at this is to invoke the concept
of theoretical hierarchies, a' la SJ Gould. Theoretical physics
would be fairly low down, near the bottom, of the hierarchy,
while, for example, medicine would be near the top. High level
fields should be explicable totally, in principle, in the terms of
the underlying field in the hierarchy. Biology is -ultimately-
explicable in terms of theoretical physics, but it's an awfully
unwieldy way to do it for several reasons:
1/ We don't know enough specifics
2/ It would take far too long anyway
3/ Sometimes you can miss seeing the wood for the trees.
>In my opinion, much harm has been done to "theoretical biology" by
>physicists who are unwilling to know how complex their favorite
>biological problem really is. (Present company excepted, I hope.)
Probably true. On the other hand, those fine folks who came up with
chaos and complexity theory have done biology a great service.
Keep it up, guys.
Shane McKee (JHO, RVH, Belfast) | / Art becomes science when
Shane at reservoir.win-uk.net --O-- you start trying to figure
AGACTGCGCTTGCTTTACACATTTCTTCTC / | out what the heck you're doing
More information about the Mol-evol
mailing list