Junk DNA
Shane McKee
shane at reservoir.win-uk.net
Fri Jul 21 16:18:46 EST 1995
Stephen Karl writes:
> As far as "junk DNA" is concerned, I think it is always good to remember...
> There are two types of non-coding DNA of unknown origin or
> purpose:
>
> 1) Garbage DNA and
> 2) Junk DNA
>
> As in life ... GARBAGE is something you throw out
> and
> JUNK is something you keep.
Aha.. but you don't keep junk DNA -
IT keeps YOU!!
(Nice little Dawkinsian twist, don't you think?)
Seriously, though, looking from the viewpoint of the genome as a
little ecosystem in its own right, all this becomes a lot clearer.
Someone posted recently on the fact that two closely related
species of deer differ greatly in the number of chromosomes - one
had only four pairs, while the other had forty, or something like
that. Anyone know if the one with fewer chromosomes has any less
junk DNA than the other, or are the chromosomes just ten times as
big?
Anyone care to speculate as to how this situation came about in
these deer? (Even as a thought experiment, it can be quite
instructive).
All the best,
Shane
Shane McKee (JHO, RVH, Belfast) | / Art becomes science when
Shane at reservoir.win-uk.net --O-- you start trying to figure
AGACTGCGCTTGCTTTACACATTTCTTCTC / | out what the heck you're doing
More information about the Mol-evol
mailing list