Junk DNA -> muntjac deer chromosomes

Richard Gordon gordonr at cc.UManitoba.CA
Sun Jul 23 23:44:58 EST 1995


Dear Shane,

I've done a literature search on the muntjac deer from the point of view
of stability of morphology in the face of extreme differences in
karyotype. This example shows that the logic of the program of development
is pretty independent of the chromosomes. As to the evolutionary mechanism
that produced this situation, and differences in junk DNA, see the papers 
listed below. 

-Dick Gordon, U. Manitoba[Jul23,95]

On Fri, 21 Jul 1995, Shane McKee wrote:
> Someone posted recently on the fact that two closely related
> species of deer differ greatly in the number of chromosomes - one
> had only four pairs, while the other had forty, or something like
> that. Anyone know if the one with fewer chromosomes has any less
> junk DNA than the other, or are the chromosomes just ten times as
> big?
> 
> Anyone care to speculate as to how this situation came about in
> these deer? (Even as a thought experiment, it can be quite
> instructive).
> 
> All the best,
> Shane
>  
> 
> 
> Shane McKee (JHO, RVH, Belfast)  | /      Art becomes science when
> Shane at reservoir.win-uk.net     --O--    you start trying to figure
> AGACTGCGCTTGCTTTACACATTTCTTCTC / |  out what the heck you're doing
> 
Works on Muntjac Deer
from Dick Gordon's Bibliography


Brinkley, B.R., M.M. Valdivia, A. Tousson & S.L. Brenner (1984). Compound 
kinetochores of the Indian muntjac. Evolution by linear fusion of unit 
kinetochores. Chromosoma.  91(1), 1-11. 
Duan, X.S. & S.Y. Lin (1983). Study of chromosomal replication of red 
muntjac (Muntiacus muntjac). Sci. Sin. B.  26(9), 936-942. 
Johnston, F.P., R.B. Church & C.C. Lin (1982). Chromosome rearrangement 
between the Indian muntjac and Chinese muntjac is accompanied by a 
deletion of middle repetitive DNA. Can. J. Biochem.  60(5), 497-506. 
Korf, B.R., E.L. Gershey & E.G. Diacumakos (1982). Centromeres are 
arranged in clusters throughout the muntjac cell cycle. Exp. Cell. Res.  
139(2), 393-396. 
Lee, C., R. Sasi & C.C. Lin (1993). Interstitial localization of 
telomeric DNA sequences in the Indian muntjac chromosomes: further 
evidence for tandem chromosome fusions in the karyotypic evolution of the 
Asian muntjacs. Cytogenet. Cell. Genet.  63(3), 156-159. 
Levy, H.P., R.A. Schultz & M.M. Cohen (1992). Comparative gene mapping in 
the species Muntiacus muntjac. Cytogenet. Cell. Genet.  61(4), 276-281. 
Levy, H.P., R.A. Schultz, J.V. Ordonez & M.M. Cohen (1993). DNA content 
measurements and an improved idiogram for the Indian muntjac. Cytometry  
14(4), 362-368. 
Liming, S. & S. Pathak (1981). Gametogenesis in a male Indian muntjac X 
Chinese muntjac hybrid. Cytogenet. Cell Genet.  30, 152-156. 
Liming, S., Y. Yingying & D. Xingsheng (1980). Comparative cytogenetic 
studies on the red muntjac, Chinese muntjac and their F1 hybrids. 
Cytogen. Cell Genet.  26, 22-27. 
Lin, C.C., R. Sasi, Y.S. Fan & Z.Q. Chen (1991). New evidence for tandem 
chromosome fusions in the karyotypic evolution of Asian muntjacs. 
Chromosoma.  101(1), 19-24. 
Ma, K. & L.M. Shi (1988). [Comparative studies on synaptonemal complexes 
in spermatocytes of Chinese muntjac Muntiacus reevesi, black muntjac M. 
crinifrons and Indian muntjac M. muntjak]. I. Chuan. Hsueh. Pao.  15(4), 
282-289. 
Mullinger, A.M. & R.T. Johnson (1983). Units of chromosome replication 
and packing. J. Cell. Sci.  179-193. 
Paweletz, N., B.K. Vig & E.M. Finze (1989). Evolution of compound 
centromeres. A new phenomenon. Cancer. Genet. Cytogenet.  42(1), 75-86. 
Rachel, A.J., T. Sharma & V.V. Menon (1992). Differences in 
sister-chromatid exchange frequency between homologous chromosomes in 
Muntiacus muntjak. Mutat. Res.  283(3), 193-198. 
Rattner, J.B. & Bazett-Jones-DP (1988). Electron spectroscopic imaging of 
the centrosome in cells of the Indian muntjac. J. Cell. Sci.  91( Pt 1), 
5-11. 
Rattner, J.B. & Bazett-Jones-DP (1989). Kinetochore structure: electron 
spectroscopic imaging of the kinetochore. J. Cell. Biol.  108(4), 
1209-1219. 
Scherthan, H. (1990). Localization of the repetitive telomeric sequence 
(TTAGGG)n in two muntjac species and implications for their karyotypic 
evolution. Cytogenet. Cell. Genet.  53(2-3), 115-117. 
Scherthan, H., U. Arnason & A. Lima-de-Faria (1990). Localization of 
cloned, repetitive DNA sequences in deer species and its implications for 
maintenance of gene territory. Hereditas  112(1), 13-20. 
Scherthan, H., U. Arnason & Lima-de-Faria-A (1987). The chromosome field 
theory tested in muntjac species by DNA cloning and hybridization. 
Hereditas.  107(2), 175-184. 
Sen, P. & T. Sharma (1985). Characterization of G-banded chromosomes of 
the Indian muntjac and progression of banding patterns through different 
stages of condensation. Cytogenet. Cell. Genet.  39(2), 145-149. 
Verma, R.S., J.P. Jacob & A. Babu (1986). Heterochromatin organization in 
the nucleus of Indian muntjac (Muntiacus muntjak). Can. J. Genet. Cytol.  
28(4), 628-630. 
Wang, D.S., S.W. Li, C.Q. Zeng, R.X. Cheng & S.B. Xue (1988). Microtubule 
and microfilament distribution and tubulin content in the cell cycle of 
Indian muntjac cells. Cytometry.  9(4), 368-373. 
Weier, H.U. & W.G. Eisert (1987). Two-parameter data acquisition system 
for rapid slit-scan analysis of mammalian chromosomes. Cytometry.  8(1), 
83-90. 
Welter, D.A., D.A. Black & L.D. Hodge (1984). Chromosome stabilizing 
structures in mitotic Indian muntjac (Muntiacus muntjak) cells. 
Experientia.  40(8), 871-873. 
Welter, D.A., D.A. Black & L.D. Hodge (1986). Chromatid behavior in late 
mitosis: a scanning electron microscopy analysis of mammalian cell lines 
with various chromosome numbers. Scan. Electron. Microsc.   1986(Pt 4), 
1371-1379. 
Wurster, D.H. & N.B. Atkin (1972). Muntjac chromosomes: a new karyotype 
for Muntiacus muntjak. Experientia  28, 972-973. 
Zinkowski, R.P., J. Meyne & B.R. Brinkley (1991). The 
centromere-kinetochore complex: a repeat subunit model. J. Cell. Biol.  
113(5), 1091-1110. 




More information about the Mol-evol mailing list