Molecular systematics - is it all rubbish?
Shane McKee
shane at reservoir.win-uk.net
Wed Jun 14 13:28:43 EST 1995
In article <3rmlb8$i5u at cronkite.ocis.temple.edu>,
Bert Gold (gold at astro.ocis.temple.edu) writes:
>Random mutation and reassortment don't appear to be adequate to me to
>explain all observable molecular genetics. And I think that this issue
>rather than clock, should be consuming our interest.
All observable molecular genetics ultimately derives from, and is
regenerated from, the DNA code. All differences between species in
terms of their DNA turn out to be the same in kind to differences
observable between individual members of species, and explicable
in terms of these differences. We have theoretical and observed
confirmation that selection and neutral drift are up to the task
of fixing these differences in populations.
What's the problem?
Shane McKee (JHO, RVH, Belfast) | / Art becomes science when
Shane at reservoir.win-uk.net --O-- you start trying to figure
AGACTGCGCTTGCTTTACACATTTCTTCTC / | out what the heck you're doing
More information about the Mol-evol
mailing list