Crustacean ITS Phylogeny and PCR
Ari Kahn
ak01706 at swt.edu
Wed Feb 5 21:36:11 EST 1997
I am looking at the phylogeny of the crustacean Triops using rDNA (ITS)
sequences. DNA isolations of high molecular weight have been
successful. However, our ITS amplifications are not working. The
primers used were originally developed for fungus** and work in plants
very well. We fear that amplification is not possible because of the
primer sequences. Has anyone done any PCR work with crustaceans or
other animals on the ITS region and if so, can you suggest some
alternative primer sequences or a proven PCR method? The sequences we
are using have the following sequences:
P1: GGAAGTAAAAGTCGTAACAAGG
P4: TCCTCCGCTTATTGATATGC
and was taken from the following reference:
Kim, K-J. and Jansen, R.K. (1994) Comparison of phylogenetic
hypotheses among different data sets in dwarf dandelions (Krigia ):
additional information from internal transcribed spacer sequences of
nuclear ribosomal DNA. Plant Syst. Evol. 190: 157-185.
**White, T. J., Burns, T., Lee, S., Taylor, J. (199). Amplification
and direct sequencing of fungal ribosomal RNA genes for phylogenetics.
In Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J., (eds.),
PCR protocols: a guide to methods and applications, pp. 315-322.
SanDiego, California.
Thank you,
--
"There is a theory which states that if ever anybody discovers exactly
what the Universe is for and why it is here, it will instantly disappear
and be replaced by something even more bizarre and inexplicable.
There is another theory which states that this has already happened."
*Douglas Adams
Ari Kahn
ak01706 at swt.edu
http://www.swt.edu/~ak01706
http://www.bio.swt.edu/PE/pelab.html
More information about the Mol-evol
mailing list