IGS pcr problem

[Moulliard Charles]

Hi,

Could I have your opinion on this problem. I try to amplify the IGS 
region of Penicillium terverticillate using the above primers 
(CNS1/CNL12 or 28S-IGS/CNS1).

GAGACAAGCATATGACTAC     CNS1 (beginnning of the 28S)
CTGAACGCCTCTAAGTCAG     CLN12 (end of the 28S)
GTAAGCGGTCAAGTAGCCTT    28S-IGS cfr séquences (Accession number U27453 
et Z27114 Genbank) (idem)

Unfortunately, the primers doesn't fail to amplify the IGS. What is 
incredible, is that the primer 28S-IGS is present in the sequences of 
the Penicillium hordei and the Aspergillus nidulans. With the Fusarium 
oxysporum, the region is amplify with the two couple of primers.

Have you an idea about the problem?

Sincerely yours,

Charles Moulliard (moulliard at mbla.ucl.ac.be)