T7 terminator II

Dominic-Luc Webb molmed domweb at mbox.ki.se
Thu Aug 9 12:31:44 EST 2001



To continue the saga of the T7 terminator... I compared
our vector (backbone is Invitrogen pRc/CMV, mammalian) 3' of
the MCS to the T7 terminator identified by Novagen in their
pET vector (bacterial protein expression vector) located in a
comparable region to our pRc/CMV vector.

Out of 73 positions 38 bases matched with 11 gaps, I get
something like 52% of bases matching. This seems like a T7
transcription terminator-like sequence. I have no idea if
this is close enough.

Anyone have any idea if this is good enough to serve as a
functional terminator for protein expression? Anyone used
pRcCMV for in vitro transcription, or prokaryote protein
expression, for instance?


Excerpt from the alignment. Upper rows are pET T7 terminator.
Lower rows are the vector in question.


CCGCTGAGCAATAACTA-GCATA 22
CCAGTGTGCTGGAATTCTGCAGA 60
**  ** **   ** *  *** *

-ACCC------CTTGGGGCCTCTAAAC---GGGTCTTGAGGGGTTTTTTG---------- 62
TATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGAGGGCCCTATTCTATAGTGTCA 120
 * **      ** * **** **  *    *  *** *****   * **



Dominc






More information about the Proteins mailing list