T7 terminator seq needed -- here it is.

[Dr. Peter Gegenheimer]

On Thu, 9 Aug 2001 15:33:46, Dominic-Luc Webb molmed <domweb at mbox.ki.se>
wrote:

<snip>|
| Do I really need so many bases for a fully functional
| T7 Tf?

Absolutely -- functional terminator hairpin RNAs need to be about 15 -
20 nt of dsRNA. Not only the terminators for the strong phage RNA
polymerases, but also those for the most efficient bacterial RNA
polymerases -- the anti-terminating polymerases which transcribe rRNA
operons -- are about 40 nt long. (See below.)
|
| Could someone direct me to a "known" functional
| sequence that will serve this function and where
| it should be optimally located relative our gene
| we are cloning?

Sequences --
Major T7 terminator, from the major (gene 10 coat protein) transcript.
Termination occurs towards the end of the run of U's. I think I show the
correct base-pairing.

>T7ter     T7 transcription terminator in pET3a.
;<<<<<<<::: <:<<:-:--: -:>>:>:::> >>>>>>
 AACCCCTTGG GGCCTCTAAA CGGGTCTTGA GGGGTTTTTT G

E. coli RNA polymerase terminator, from the rrnD operon. (The other rrn
terminators are similar.) Termination is at the end. Note the
stabilizing central GNRA tetraloop.

>rrnD-ter    Starts at the first base 3' to rrfD2 (5S rRNA #2).
;<<<<<<<<<<<<<<<<<<---->>>>>>>>>>>>>>>>>>
 AAAACAAAAGGCTCAGTCGGAAGACTGGGCCTTTTGTTTT

Location -- doesn't matter, but must be downstream of coding region and
unable to engage in (alternate) secondary formation with the coding
sequence!

| Given that our present plasmid lacks this (it started
| its life as a mammalian system using the T7 promoter
| only for sequencing), is it common knowledge that the
| lack of the terminator sequence can result in drastic
| reduction in mRNA transcript, thus explaining my low
| protein expression?

No, this isn't common knowledge! The lack of a terminator will
_definitely_ cause problems only if another gene (whose expression is
harmful) is encoded downstream of the T7-controlled gene.

(For example, in most of the pET vectors, the beta-lactamase gene
(Amp-R) is downstream of, and in the same orientation, the T7 promoter.
Run-on transcription from the T7 promoter -- or even read-through past
the T7 terminator, which is said to be only ca. 90% efficient -- will
result in elevated levels of B-lactamase. This, in turn, could deplete
all the Amp from the growth medium, and allow the growth of
non-expressing clones.)

We have used, very successfully, a clone which lacked the T7 terminator.
I kept telling my student that the terminator was needed, and he kept
showing me that it wasn't...

o----------------------------------------------------------------------o
| Dr. Peter Gegenheimer       | Vox: 785-864-3939  FAX: 785-864-5321   |
| Department of               |   PGegen at KU.nospam.edu                 |
|   Molecular Biosciences     |   http://rnaworld.bio.ku.edu/          |
| University of Kansas        |"When you have excluded the impossible, |
| 1200 Sunnyside Ave.         |  whatever remains, however improbable, |
| Lawrence  KS  66045-7534    |  must be the truth."      S. Holmes    |
o_____________________________|________________________________________o