YCp50 sequence

Stillman Stillman at BIOSCIENCE.BIOLOGY.UTAH.EDU
Sun Apr 25 14:05:32 EST 1993


RE>YCp50 sequence
Dan,
I have put together DNA sequence files for YCp50 and YEp24, which are listed
below.

David Stillman
Department of Cellular, Viral and Molecular Biology
University of Utah Medical Center
Salt Lake City, UT 84132
stillman at bioscience.utah.edu
phone: 801-581-5429
fax: 801-581-3607

YCp50 sequence file notes:
Creating a Sequence File containing YCp50
Based on Mark Rose's paper Gene 60, 237-243  (1987)
1.	Starting with pBR322, paste in 1.1 kb HindIII URA3 fragment into the AvaI
site as follows: All overhangs chewed off, 10 G's added to nt 1428-1437 10 C's
added to nt 2601-2610.  [dG/dC tailing].  This is YIp5.
2.	CEN4 from PvuII to EcoRI was ligated to ARS1 EcoR1 to Hind III.  Then 190 nt
was deleted around EcoRI site [85 nt on either side.] I have deleted the BalI
site; Rose left this intact, but were not sure.
3.	The CEN4-ARS1 fragment [PvuII - CEN4 - dead EcoRI - ARS1 - HindIII/klenowed]
was put into the PvuII site of YIp5.  Rose notes that the PvuII site was not
regenerated.  To accomplish this, while retaining concordance with Rose's
restriction site numbering, I changed CAGCTG to CAGGTG.  

YCp50 sequence (7950 bp; sequence file constructed by David Stillman):
GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGG
CACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTT
ATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCT
ATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCG
CTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATC
GTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCG
CCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCT
CCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCG
CATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTAT
CGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCG
AGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCC
TTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTA
CGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGC
CCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACC
AGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATG
GATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAA
TGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATG
CGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCGGGGGGGGGGTT
TCAATTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCTTTGAAATTTTTTTGATTCGGTAATCTCCG
AACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAAAT
TGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATCATGTCGAAAGCTACATATAA
GGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTG
CTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACA
CATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTT
ACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAG
AATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTA
ACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGG
TACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAG
GTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTG
GATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGA
GGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAG
TAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCGGGAATCTCGGTCGTAAT
GATTTTTATAATGACGAAAAAAAAAAAATTGGAAAGAAAACCCCCCCCCCGCAGCGTTGGGTCCTGGCCACGGGTGCGCA
TGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGC
GAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTC
GTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCT
GTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACC
GCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCG
TTTCATCGGTATCATTACCCCCATGAACAGAAATTCCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGC
CCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGG
CAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGGTGGGCCATTCTCATGAAGAATATCTTGAAT
TTATTGTCATATTACTAGTTGGTGTGGAAGTCCATATATCGGTGATCAATATAGTGGTTGACATGCTGGCTAGTCAACAT
TGAGCCTTTTGATCATGCAAATATATTACGGTATTTTACAATCAAATATCAAACTTAACTATTGACTTTATAACTTATTT
AGGTGGTAACATTCTTATAAAAAAGAAAAAAATTACTGCAAAACAGTACTAGCTTTTAACTTGTATCCTAGGTTATCTAT
GCTGTCTCACCATAGAGAATATTACCTATTTCAGAATGTATGTCCATGATTCGCCGGGTAAATACATATAATACACAAAT
CTGGCTTAATAAAGTCTATAATATATCTCATAAAGAAGTGCTAAATTGGCTAGTGCTATATATTTTTAAGAAAATTTCTT
TTGACTAAGTCCATATCGACTTTGTAAAAGTTCACTTTAGCATACATATATTACACGAGCCAGAAATTGTAACTTTTGCC
TAAAATCACAAATTGCAAAATTTAATTGCTTGCAAAAGGTCACATGCTTATAATCAACTTTTTTAAAAATTTAAAATACT
TTTTTATTTTTTATTTTTAAACATAAATGAAATAATTTATTTATTGTTTATGATTACCGAAACATAAAACCTGCTCAAGA
AAAAGAAACTGTTTTGTCCTTGGAAAAAAAGCACTACCTAGGAGCGGCCAAAATGCCGAGGCTTTCATAGCTTAAACTCT
TTACAGAAAATAGGCATTATAGATCAGTTCGAGTTTTCTTATTCTTCCTTCCGGTTTTATCGTCACAGTTTTACAGTAAA
TAAGTATCACCTCTTAGAGTTAACTATGAGATAAGCAAGTATCATCTCATTTCATTTACCTGAAGTCGAGTAAACAGAAA
ATCCAATTGTTGATGAACCTCAATGACTTAGAACTATCTATCGGCAGATCATATAAAGAGGATTTAGGTACCTAGAGGAC
TGTACCTGGAGTATATATATATATATATATATATTATCTCAACTATAGTCCATAGAGGTTTCTTTCTTGAGGCCTTAAAC
TGCTAAAGAATGATATTGGTGGAATGCAAGCACCAATCTCTCTTCTTTCGTAACTGTTCATATACTTCAAACCAAGAATG
TAACGGGCATTGACCCATCCAAAACCTTCAGTAGCTGCCCCTTTAAAGTCAGCACCTTGATTACCGTATTCTGCTTCAAC
ACGATGAGGATCTGTTCCTCTTGTGACATCATATTTTTCAACCACAATACCATTATAATCGACAAAAGCCTTTGTCATCA
TGAAAAGCCATCTATAAGCTAGCCTATTCGTTACAGTTAAATAACCATAAGAACGGAGGCCTTCCCAAGCAAGAATTTGA
TGGGGTGCCCAACCAAATGGATAGTCCCATTGTCTAATTGGTCTCGAAATAGAAATTGGGCCTCGAGAACGCTCCGTACA
TGCAGCTAAACCTCCAAGCATCTCTAACTTGGGTAGTGCTTTCTCCACCATTTTCTGTGCTTGCTCCTTCGTGGCAAGTC
CAGCCCATAATGCCCAGAATGTAGTTGCGGATTCGTATGACGTTCTGTGCTTGATTTTTGTGTTGTAGTCAAAGAAAAAC
CCCGACTCGTCATCCCACATATATTTGGTAATTGATGAGGCAACGCTAATTATCAACATATAGATTGTTATCTATCTGCA
TGAACACGAAATCTTTACTTGACGACTTGAGGCTGATGGTGTTTATGCAAAGAAACCACTGTGTTTAATATGTGTCACTG
TTTGATATTACTGTCAGCGTAGAAGATAATAGTAAAAGCGGTTAATAAGTGTATTTGAGATAAGTGTGATAAAGTTTTTA
CAGCGAAAAGACGATAAATACAAGAAAATGATTACGAGGATACGGAGAGAGGTATGTACATGTGTATTTATATACTAAGC
TGCCGGCGGTTGTTTGCAAGACCGAGAAAAGGCTAGCAAGAATCGGGTCATTGTAGCGTATGCGCCTGTGAACATTCTCT
TCAACAAGTTTGATTCCATTGCGGTGAAATGGTAAAAGTCAACCCCCTGCGATGTATATTTTCCTGTACAATCAATCAAA
AAGCCAAATGATTTAGCATTATCTTTACATCTTGTTATTTTACAGATTTTATGTTTAGATCTTTTATGCTTGCTTTTCAA
AAGGCCTGCAGGCAAGTGCACAAACAATACTTAAATAAATACTACTCAGTAATAACCTATTTCTTAGCATTTTTGACGAA
ATTTGCTATTTTGTTAGAGTCTTTTACACCATTTGTCTCCACACCTCCGCTTACATCAACACCAATAACGCCATTTAATC
TAAGCGCATCACCAACATTTTCTGGCGTCAGTCCACCAGCTAACATAAAATGTAAGCTCTGCCTCGCGCGTTTCGGTGAT
GACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGC
CCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATA
CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAA
GGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG
GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG
CCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACA
AAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTC
GTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCA
TAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC
CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCC
ACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACAC
TAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCA
AACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGAT
CCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAA
AAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG
ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCC
GTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACC
GGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCA
TCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCT
GCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG
ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTAT
CACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTAC
TCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCC
ACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA
AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCA
ATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAG
GGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAAT
AGGCGTATCACGAGGCCCTTTCGTCTTCAA

YEp24 sequence file notes:
Creating a Sequence File containing YEp24
Starting with pBR322, a 1.1 kb URA3 HindIII fragment was inserted into HindIII
site, and a 2.2 kb EcoRI fragment from 2 micron [form B] was inserted into Eco
RI site. 

YEp24 sequence (7769 bp; sequence file constructed by David Stillman):
GAATTCTGAACCAGTCCTAAAACGAGTAAATAGGACCGGCAATTCTTCAAGCAATAAACAGGAATACCAATTATTAAAAG
ATAACTTAGTCAGATCGTACAATAAAGCTTTGAAGAAAAATGCGCCTTATTCAATCTTTGCTATAAAAAATGGCCCAAAA
TCTCACATTGGAAGACATTTGATGACCTCATTTCTTTCAATGAAGGGCCTAACGGAGTTGACTAATGTTGTGGGAAATTG
GAGCGATAAGCGTGCTTCTGCCGTGGCCAGGACAACGTATACTCATCAGATAACAGCAATACCTGATCACTACTTCGCAC
TAGTTTCTCGGTACTATGCATATGATCCAATATCAAAGGAAATGATAGCATTGAAGGATGAGACTAATCCAATTGAGGAG
TGGCAGCATATAGAACAGCTAAAGGGTAGTGCTGAAGGAAGCATACGATACCCCGCATGGAATGGGATAATATCACAGGA
GGTACTAGACTACCTTTCATCCTACATAAATAGACGCATATAAGTACGCATTTAAGCATAAACACGCACTATGCCGTTCT
TCTCATGTATATATATATACAGGCAACACGCAGATATAGGTGCGACGTGAACAGTGAGCTGTATGTGCGCAGCTCGCGTT
GCATTTTCGGAAGCGCTCGTTTTCGGAAACGCTTTGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAAC
TTCAGAGCGCTTTTGAAAACCAAAAGCGCTCTGAAGACGCACTTTCAAAAAACCAAAAACGCACCGGACTGTAACGAGCT
ACTAAAATATTGCGAATACCGCTTCCACAAACATTGCTCAAAAGTATCTCTTTGCTATATATCTCTGTGCTATATCCCTA
TATAACCTACCCATCCACCTTTCGCTCCTTGAACTTGCATCTAAACTCGACCTCTACATTTTTTATGTTTATCTCTAGTA
TTACTCTTTAGACAAAAAAATTGTAGTAAGAACTATTCATAGAGTGAATCGAAAACAATACGAAAATGTAAACATTTCCT
ATACGTAGTATATAGAGACAAAATAGAAGAAACCGTTCATAATTTTCTGACCAATGAAGAATCATCAACGCTATCACTTT
CTGTTCACAAAGTATGCGCAATCCACATCGGTATAGAATATAATCGGGGATGCCTTTATCTTGAAAAAATGCACCCGCAG
CTTCGCTAGTAATCAGTAAACGCGGGAAGTGGAGTCAGGCTTTTTTTATGGAAGAGAAAATAGACACCAAAGTAGCCTTC
TTCTAACCTTAACGGACCTACAGTGCAAAAAGTTATCAAGAGACTGCATTATAGAGCGCACAAAGGAGAAAAAAAGTAAT
CTAAGATGCTTTGTTAGAAAAATAGCGCTCTCGGGATGCATTTTTGTAGAACAAAAAAGAAGTATAGATTCTTTGTTGGT
AAAATAGCGCTCTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCG
TTGCATTTTTGTTTTACAAAAATGAAGCACAGATTCTTCGTTGGTAAAATAGCGCTTTCGCGTTGCATTTCTGTTCTGTA
AAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAGCGCTCTCGCGTTGCATTTTTGTTCTACAAAATGAAGCACAGATGC
TTCGTTAACAAAGATATGCTATTGAAGTGCAAGATGGAAACGCAGAAAATGAACCGGGGATGCGACGTGCAAGATTACCT
ATGCAATAGATGCAATAGTTTCTCCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCGCTAGACTATATATTATTAT
ACAGGTTCAAATATACTATCTGTTTCAGGGAAAACTCCCAGGTTCGGATGTTCAAAATTCAATGATGGGTAACAAGTACG
ATCGTAAATCTGTAAAACAGTTTGTCGGATATTAGGCTGTATCTCCTCAAAGCGTATTCGAATATCATTGAGAAGCTGCA
GCGTCACATCGGATAATAATGATGGCAGCCATTGTAGAAGTGCCTTTTGCATTTCTAGTCTCTTTCTCGGTCTAGCTAGT
TTTACTACATCGCGAAGATAGAATCTTAGATCACACTGCCTTTGCTGAGCTGGATCAATAGAGTAACAAAAGAGTGGTAA
GGCCTCGTTAAAGGACAAGGACCTGAGCGGAAGTGTATCGTACAGTAGACGGAGTATACTAGTATAGTCTATAGTCCGTG
GAATTCTCATGTTTGACAGCTTATCATCGATaAGCTTTTCAATTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATT
TCGGTTTCTTTGAAATTTTTTTGATTCGGTAATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGG
TATATATACGCATATGTAGTGTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGC
AGGAAACGAAGATAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCT
ATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAG
TTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTT
AAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGT
CAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAG
GTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCA
TGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGG
CTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATG
ACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGA
AGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAG
AAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTT
AATTATATCAGTTATTACCCGGGAATCTCGGTCGTAATGATTTTTATAATGACGAAAAAAAAAAAATTGGAAAGAAAAAG
CTtTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGT
CATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCG
TCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTT
CTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGAT
CATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTG
CTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTG
GGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCT
CAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAG
CCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCACTTATGACTGTCTTCTTTATCATG
CAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGCGACGATGATCGG
CCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGCG
AGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATG
GCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGA
TGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCA
CGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTC
CCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACC
ACTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGGCAGAACATATCCATCGC
GTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGCGCATGATCGTGCTCC
TGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAACGTGA
AGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGA
AACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTA
CATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTA
CCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTAT
CATTACCCCCATGAACAGAAATTCCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGC
CCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGGCAGACATCTGTG
AATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACAC
ATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGG
TGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATC
AGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGC
GCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCG
GTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG
TAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGA
GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACC
CTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCT
CAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCG
GTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGA
GCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTAT
CTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCG
GTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGG
TCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCT
TTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCA
GTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATA
CGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAAT
AAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCC
GGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGC
TCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAA
AGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCAC
TGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAA
TAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGT
GCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCA
CTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCC
GCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCA
GGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCC
GAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTT
CGTCTTCAA






More information about the Yeast mailing list