YCP50 sequence request

Bob DeLisio delisior at rnisd0.DNET.roche.com
Fri Oct 1 15:39:50 EST 1993


Sorry about the last post! Here's the real thing:
__
rapulak at macc.wisc.edu "Rock Pulak" writes:

>Oh yeah ...  if you have that YCp50 DNA sequence and would like
>to share it with me ... my email address is
>
>rapulak at macc.wisc.edu
>
>thank-you.
>
>Rock Pulak
>UW-Madison
>420 Henry Mall
>Madison, WI 53706
>
>opps!


Here it is (constructed by David Stillman). 
Good Luck.
Bob {&>)__~
=====================================================
 _/   _/     Robert DeLisio
  _/ _/      Roche Institute of Molecular Biology
    _/       Roche Research Center
   _/ _/     Nutley, New Jersey 07110-1199
  _/   _/
   _/ _/     Voice: (201) 235-3728
     _/      Fax:   (201) 235-2318
    _/ _/    Internet: delisior at rnisd0.dnet.roche.com
   _/   _/   CompuServe: 73517,2616
=====================================================

___
YCp50 sequence file notes:
Creating a Sequence File containing YCp50
Based on Mark Rose's paper Gene 60, 237-243  (1987)
1. Starting with pBR322, paste in 1.1 kb HindIII URA3 fragment into the AvaI
site as follows: All overhangs chewed off, 10 G's added to nt 1428-1437 10 C's
added to nt 2601-2610.  [dG/dC tailing].  This is YIp5.
2. CEN4 from PvuII to EcoRI was ligated to ARS1 EcoR1 to Hind III.  Then 190 nt
was deleted around EcoRI site [85 nt on either side.] I have deleted the BalI
site; Rose left this intact, but were not sure.
3. The CEN4-ARS1 fragment [PvuII - CEN4 - dead EcoRI - ARS1 - HindIII/kleno
wed] was put into the PvuII site of YIp5.  Rose notes that the PvuII site was
not regenerated.  To accomplish this, while retaining concordance with Rose's
restriction site numbering, I changed CAGCTG to CAGGTG.

YCp50 sequence (7950 bp; sequence file constructed by David Stillman):
GAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGG
CACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTT
ATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCT
ATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCG
CTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATC
GTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCG
CCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCT
CCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCG
CATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTAT
CGTCGCCGCACTTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCG
AGGACCGCTTTCGCTGGAGCGCGACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCC
TTCGTCACTGGTCCCGCCACCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTA
CGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGC
CCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAAGGATCGCTCGCGGCTCTTACC
AGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGGAACGGGTTGGCATG
GATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCTGAA
TGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATG
CGCAAACCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCGGGGGGGGGGTT
TCAATTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCTTTGAAATTTTTTTGATTCGGTAATCTCCG
AACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGTGTTGAAGAAACATGAAAT
TGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGATAAATCATGTCGAAAGCTACATATAA
GGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTG
CTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACA
CATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTT
ACTCTTCGAAGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAG
AATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTA
ACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGG
TACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAG
GTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGTCAACAGTATAGAACCGTG
GATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGA
GGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAAAAAACTGTATTATAAG
TAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCGGGAATCTCGGTCGTAAT
GATTTTTATAATGACGAAAAAAAAAAAATTGGAAAGAAAACCCCCCCCCCGCAGCGTTGGGTCCTGGCCACGGGTGCGCA
TGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGC
GAGCGAACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTC
GTAAAGTCTGGAAACGCGGAAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCT
GTGGAACACCTACATCTGTATTAACGAAGCGCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACC
GCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATGTTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCG
TTTCATCGGTATCATTACCCCCATGAACAGAAATTCCCCCTTACACGGAGGCATCAAGTGACCAAACAGGAAAAAACCGC
CCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGGACGCGGATGAACAGG
CAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGGTGGGCCATTCTCATGAAGAATATCTTGAAT
TTATTGTCATATTACTAGTTGGTGTGGAAGTCCATATATCGGTGATCAATATAGTGGTTGACATGCTGGCTAGTCAACAT
TGAGCCTTTTGATCATGCAAATATATTACGGTATTTTACAATCAAATATCAAACTTAACTATTGACTTTATAACTTATTT
AGGTGGTAACATTCTTATAAAAAAGAAAAAAATTACTGCAAAACAGTACTAGCTTTTAACTTGTATCCTAGGTTATCTAT
GCTGTCTCACCATAGAGAATATTACCTATTTCAGAATGTATGTCCATGATTCGCCGGGTAAATACATATAATACACAAAT
CTGGCTTAATAAAGTCTATAATATATCTCATAAAGAAGTGCTAAATTGGCTAGTGCTATATATTTTTAAGAAAATTTCTT
TTGACTAAGTCCATATCGACTTTGTAAAAGTTCACTTTAGCATACATATATTACACGAGCCAGAAATTGTAACTTTTGCC
TAAAATCACAAATTGCAAAATTTAATTGCTTGCAAAAGGTCACATGCTTATAATCAACTTTTTTAAAAATTTAAAATACT
TTTTTATTTTTTATTTTTAAACATAAATGAAATAATTTATTTATTGTTTATGATTACCGAAACATAAAACCTGCTCAAGA
AAAAGAAACTGTTTTGTCCTTGGAAAAAAAGCACTACCTAGGAGCGGCCAAAATGCCGAGGCTTTCATAGCTTAAACTCT
TTACAGAAAATAGGCATTATAGATCAGTTCGAGTTTTCTTATTCTTCCTTCCGGTTTTATCGTCACAGTTTTACAGTAAA
TAAGTATCACCTCTTAGAGTTAACTATGAGATAAGCAAGTATCATCTCATTTCATTTACCTGAAGTCGAGTAAACAGAAA
ATCCAATTGTTGATGAACCTCAATGACTTAGAACTATCTATCGGCAGATCATATAAAGAGGATTTAGGTACCTAGAGGAC
TGTACCTGGAGTATATATATATATATATATATATTATCTCAACTATAGTCCATAGAGGTTTCTTTCTTGAGGCCTTAAAC
TGCTAAAGAATGATATTGGTGGAATGCAAGCACCAATCTCTCTTCTTTCGTAACTGTTCATATACTTCAAACCAAGAATG
TAACGGGCATTGACCCATCCAAAACCTTCAGTAGCTGCCCCTTTAAAGTCAGCACCTTGATTACCGTATTCTGCTTCAAC
ACGATGAGGATCTGTTCCTCTTGTGACATCATATTTTTCAACCACAATACCATTATAATCGACAAAAGCCTTTGTCATCA
TGAAAAGCCATCTATAAGCTAGCCTATTCGTTACAGTTAAATAACCATAAGAACGGAGGCCTTCCCAAGCAAGAATTTGA
TGGGGTGCCCAACCAAATGGATAGTCCCATTGTCTAATTGGTCTCGAAATAGAAATTGGGCCTCGAGAACGCTCCGTACA
TGCAGCTAAACCTCCAAGCATCTCTAACTTGGGTAGTGCTTTCTCCACCATTTTCTGTGCTTGCTCCTTCGTGGCAAGTC
CAGCCCATAATGCCCAGAATGTAGTTGCGGATTCGTATGACGTTCTGTGCTTGATTTTTGTGTTGTAGTCAAAGAAAAAC
CCCGACTCGTCATCCCACATATATTTGGTAATTGATGAGGCAACGCTAATTATCAACATATAGATTGTTATCTATCTGCA
TGAACACGAAATCTTTACTTGACGACTTGAGGCTGATGGTGTTTATGCAAAGAAACCACTGTGTTTAATATGTGTCACTG
TTTGATATTACTGTCAGCGTAGAAGATAATAGTAAAAGCGGTTAATAAGTGTATTTGAGATAAGTGTGATAAAGTTTTTA
CAGCGAAAAGACGATAAATACAAGAAAATGATTACGAGGATACGGAGAGAGGTATGTACATGTGTATTTATATACTAAGC
TGCCGGCGGTTGTTTGCAAGACCGAGAAAAGGCTAGCAAGAATCGGGTCATTGTAGCGTATGCGCCTGTGAACATTCTCT
TCAACAAGTTTGATTCCATTGCGGTGAAATGGTAAAAGTCAACCCCCTGCGATGTATATTTTCCTGTACAATCAATCAAA
AAGCCAAATGATTTAGCATTATCTTTACATCTTGTTATTTTACAGATTTTATGTTTAGATCTTTTATGCTTGCTTTTCAA
AAGGCCTGCAGGCAAGTGCACAAACAATACTTAAATAAATACTACTCAGTAATAACCTATTTCTTAGCATTTTTGACGAA
ATTTGCTATTTTGTTAGAGTCTTTTACACCATTTGTCTCCACACCTCCGCTTACATCAACACCAATAACGCCATTTAATC
TAAGCGCATCACCAACATTTTCTGGCGTCAGTCCACCAGCTAACATAAAATGTAAGCTCTGCCTCGCGCGTTTCGGTGAT
GACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGC
CCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATA
CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAA
GGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCG
GTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGG
CCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACA
AAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTC
GTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCA
TAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC
CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCC
ACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACAC
TAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCA
AACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGAT
CCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAA
AAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTG
ACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCC
GTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACC
GGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCA
TCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCT
GCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATG
ATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTAT
CACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTAC
TCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCC
ACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGA
GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCA
AAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCA
ATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAG
GGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAAT
AGGCGTATCACGAGGCCCTTTCGTCTTCAA
___



More information about the Yeast mailing list