Q re. pJG4-5

Augustine Souza souza at alf.biochem.mpg.de
Mon Jul 10 05:12:53 EST 1995


Hi,

Re. the interaction trap library plasmid pJG4-5, I've compared
the sequences suggested for use as primers to characterize
inserts from the 5' direction. The Red book suggests

                  5'CTGAGTGGAGATGCCTCC3'
but                 |||||||||||||
       5'CCAGCCTCTTGCTGAGTGGAGATG3'

is suggested by Finley & Brent (in the Practical Approach
Series).

Does anyone have experience with BOTH primers and a preference?

Re. a primer for sequencing inserts in pJG4-5 from the opposite
direction, Finley & Brent suggest the primer BCO2:

                             *
GAC AAG CCG ACA ACC TTG ATT GCA G

By comparing it to several adh1 sequences in the GenBank
database, there appears to be a mismatch at the third base from
the 3' end in the BCO2 sequence. From a practical POV, has anyone
made this primer and found it to work for PCR or sequencing?

Gus Souza
Genzentrum
Munich



More information about the Yeast mailing list