HIS3 upstream sequence

pulitzer at PLAUTO.CSATA.IT pulitzer at PLAUTO.CSATA.IT
Thu Mar 16 12:25:22 EST 1995


>
>To:DEZWAAN_T.a1.mscf.upenn.edu at dl.ac.uk
>From:pulitzer at plauto.csata.it (John Pulitzer)
>Subject:Re: HIS3 upstream sequence
>
>>I am constructing a plasmid which carries the HIS3 gene from the vector
>>pJJ215.  This is one of a series of constructs made by Jones and Prakash
>>and carries the HIS3 gene as a BamHI fragment in pUC18.  I would like to
>>piece together the full sequence of my final construct but have been
>>unable to find sequence data for the region between the 5'-BamHI site
>>(-491) and the HIS3 ATG.  Does anybody know where I can find this
>>sequence?  Thanks for your help.
>>
>>Todd Dezwaan
>
Hi. Our Server does'nt like the N_T in your address, so I'm forwarding  to
the List.

>ggatccgctgcacggtcctgttccctagcatgtacgtgagcgtatttccttttaaaccacgacgctttgtcttcattca
>a
>cgtttcccattgtttttttctactattgctttgctgtgggaaaaacttatcgaaagatgacgactttttcttaattctc
>g
>ttttaagagcttggtgagcgctaggagtcactgccaggtatcgtttgaacacggcattagtcagggaagtcataacaca
>g
>tcctttcccgcaattttctttttctattactcttggcctcctctagtacactctatatttttttatgcctcggtaatga
>t
>tttcatttttttttttccacctagcggatgactctttttttttcttagcgattggcattatcacataatgaattataca
>t
>tatataaagtaatgtgatttcttcgaagaatatactaaaaaatgagcaggcaagataaacgaaggcaaagATGACAGAG
>C
>AGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGAT
>A
>GAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATTAACGTCCACA
>C
>AGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAGTCGATTGGT
>G
>ACTTACACATAGACGACCATCACACCACTGAAGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGCCCTACTGGG
>G
>CGTGGAGTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTAGATCTTTCGAACA
>G
>GCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGAGATCTCTCTTGCGAGATGATCCCGCATTTTCTT
>G
>AAAGCTTTGCAGAGGCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGCCAAGAATGATCATCACCGTAGTGAGAG
>T
>GCGTTCAAGGCTCTTGCGGTTGCCATAAGAGAAGCCACCTCGCCCAATGGTACCAACGATGTTCCCTCCACCAAAGGTG
>T
>TCTTATGTAGTGACACCGATTATTTAAAGCTGCAGCATACGATATATATATACATGTGTATATATGTATACCTATGAAT
>G
>TCAGTAAGTATGTATACGAACAGTATGATACTGAAGATGACAAGGTAATGCATCATTCTATACGTGTCATTCTGAACGA
>G
>GCGCGCTTTCCTTTTTTCTTTTTGCTTTTTCTTTTTTTTTCTCTTGAACTCGAGAAAAAAAATATAAAAGAGATGGAGG
>A
>ACGGGAAAAAGTTAGTTGTGGTGATAGGTGGCAAGTGGTATTCCGTAAGAACAACAAGAAAAGCATTTCATATTATGGC
>T
>GAACTGAGCGAACAAGTGCAAAATTTAAGCATCAACGACAACAACGAGAATGGTTATGTTCCTCCTCACTTAAGAGGAA
>A
>ACCAAGAAGTGCCAGAAATAACATGAGCAACTACAATAACAACAACGGCGGCTACAACGGTGGCCGTGGCGGTGGCAGC
>T
>TCTTTAGCAACAACCGTCGTGGTGGTTACGGCAACGGTGGTTTCTTCGGTGGAAACAACGGTGGCAGCAGATCTAACGG
>C
>CGTTCTGGTGGTAGATGGATCGATGGCAAACATGTCCAAGCTCCAAGAAACGAAAAGGCCGAGATCGCCATATTTGGTG
>T
>CCCCGAGGATCC
>
>This is the entire HIS3 BamH1 fragment sequence (extracted  from the deposited
>CHR3 sequence). Greetings. John
>

John F. Pulitzer
Dept. of Genetics and Molecular Biology
U. of Naples "Federico II"
via Mezzocannone, 8
80134 Naples (Italy)
(tel. 3981-552-6208; ext. 221)
(FAX 3981-552-7950)











More information about the Yeast mailing list