Sequence Info for URA3?

Dr. Charles Miller rellim at MAILHOST.TCS.TULANE.EDU
Tue Oct 15 09:39:05 EST 1996


Hi Namjin,

The folks at Invitrogen sent me the sequence (see below) for pYES2.See
"cis and trans-Acting Regulatory Elements of the Yeast URA3 Promoter" in 
Mol. Cell. Biol. 10:5257-70, 1990 by A. Roy, F. Exinger and R. Losson 
and compare that to what is present in pYES2 to determine what 5' 
sequences you want to include in your pcr fragment.

pYES2:
GGCCGCAAATTAAAGCCTTCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAATGTTACATGCGT
ACACGCGTCTGTACAGAAAAAAAAGAAAAATTTGAAATATAAATAACGTTCTTAATACTAACATAACTATAA
AAAAATAAATAGGGACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGTGGGGGGAG
GGCGTGAATGTAAGCGTGACATAACTAATTACATGATGCGGCCCTCTAGATGCATGCTCGAGCGGCCGCCAG
TGTGATGGATATCTGCAGAATTCCAGCACACTGGCGGCCGTTACTAGTGGATCCGAGCTCGGTACCAAGCTT
AATATTCCCTATAGTGAGTCGTATTACAGCTGCTAGTAGTCCGATCCGGGGTTTTTTCTCCTTGACGTTAAA
GTATAGAGGTATATTAACAATTTTTTGTTGATACTTTTATTACATTTGAATAAGAAGTAATACAAACCGAAA
ATGTTGAAAGTATTAGTTAAAGTGGTTAATGCAGTTTTTGCATTTATATATCTGTTAATAGATCAAAAATCA
TCGCTTCGCTGATTAATTACCCCAGAAATAAGGCTAAAAAACTAATCGCATTATCATCCTATGGTTGTTAAT
TTGATTCGTTCATTTGAAGGTTTGTGGGGCCAGGTTACTGCCAATTTTTCCTCTTCATAACCATAAAAGCTA
GTATTGTAGAATCTTTATTGTTCGGAGCAGTGCGGCGCGAGGCACATCTGCGTTTCAGGAACGCGACCGGTG
AGGACGAGGACGCACGGAGGAGAGTCTTCCTTCGGAGGGCTGTCACCCGCTCGGCGGCTTCTAATCCGTACT
AGTGGATCATCCCCACGCGCCCTGTAGCGCCCCATTAAGCGCGGCGGGTGTGGTGGTTACGCCCAGCGTGAC
CCCTACACTTCCCACCGCCCTAGCCCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGG
CTTTCCCCGTCAAGCTCTAAATGGGGGCATCCGTTTACCCTTCCGATTTACTGCTTTACGGCACCTCGACCC
CAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACCCTTTTTCGCCCTTTGAC
GTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTGGAAACTGGAACAACACTCAACCCTATCTCGGTCTA
TTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGGCTATTCGTTAAAAAATGAGCTGATTTAACAAAAATT
TAACGCGAATTTTAACAAAATATTAACGTTTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGG
GCTTTTCTGATTATCAACCGGGGTGGAGCTTCCCATTGCGAATACCGCTTCCACAAACATTGCTCAAAAGTA
TCTCTTTGCTATATATCTCTGTGCTATATCCCTATATAACCTACCCATCCACCTTTCGCTCCTTGAACTTGC
ATCTAAACTCGACCTCTACATTTTTTATGTTTATCTCTAGTATTACTCTTTAGACAAAAAAATTGTAGTAAG
AACTATTCATAGAGTGAATCGAAAACAATACGAAAATGTAAACATTTCCTATACGTAGTATATAGAGACAAA
ATAGAAGAAACCGTTCATAATTTTCTGACCAATGAAGAATCATCAACGCTATCACTTTCTGTTCACAAAGTA
TGCGCAATCCACATCGGTATAGAATATAATCGGGGATGCCTTTATCTTGAAAAAATGCACCCGCAGCTTCGC
TAGTAATCAGTAAACGCGGGAAGTGGAGTCAGGCTTTTTTTATGGAAGAGAAAATAGACACCAAAGTAGCCT
TCTTCTAACCTTAACGGACCTACAGTGCAAAAAGTTATCAAGAGACTGCATTATAGAGCGCACAAAGGAGAA
AAAAAGTAATCTAAGATGCTTTGTTAGAAAAATAGCGCTCTCGGGATGCATTTTTGTAGAACAAAAAAGAAG
TATAGATTCTTTGTTGGTAAAATAGCGCTCTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCT
TTGTTTGAAAAATTAGCGCTCTCGTCGCGTTGCATTTTTGTTTTACAAAAATGAAGCACAGATTCTTCGTTG
GTAAAATAGCGCTTTCGCGTTGCATTTCTGTTCTGTAAAAATGCAGCTCAGATTCTTTGTTTGAAAAATTAG
CGCTCTCGCGTTGCATTTTTGTTCTACAAAATGAAGCACAGATGCTTCGTTAACAAAGATATGCTATTGAAG
TGCAAGATGGAAACGCAGAAAATGAACCGGGGATGCGACGTGCAAGATTACCTATGCAATAGATGCAATAGT
TTCTCCAGGAACCGAAATACATACATTGTCTTCCGTAAAGCGCTAGACTATATATTATTATACAGGTTCAAA
TATACTATCTGTTTCAGGGAAAACTCCCAGGTTCGGATGTTCAAAATTCAATGATGGGTAACAAGTACGATC
GTAAATCTGTAAAACAGTTTGTCGGATATTAGGCTGTATCTCCTCAAAGCGTATTCGAATATCATTGAGAAG
CTGCAGCGTCACATCGGATAATAATGATGGCAGCCATTGTAGAAGTGCCTTTTGCATTTCTAGTCTCTTTCT
CGGTCTAGCTAGTTTTACTACATCGCGAAGATAGAATCTTAGATCACACTGCCTTTGCTGAGCTGGATCAAT
AGAGTAACAAAAGAGTGGTAAGGCCTCGTTAAAGGACAAGGACCTGAGCGGAAGTGTATCGTACAGTAGACG
GAGTATCTAGTATAGTCTATAGTCCGTGGAATTAATTCTCATCTTTGACAGCTTATCATCGATAAGCTAGCT
TTTCAATTCAATTCATCATTTTTTTTTTATTCTTTTTTTTGATTTCGGTTTCTTTGAAATTTTTTTGATTCG
GTAATCTCCGAACAGAAGGAAGAACGAAGGAAGGAGCACAGACTTAGATTGGTATATATACGCATATGTAGT
GTTGAAGAAACATGAAATTGCCCAGTATTCTTAACCCAACTGCACAGAACAAAAACCTGCAGGAAACGAAGA
TAAATCATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTT
AATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAG
TTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATG
GAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAAGACAGAAAATTT
GCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATT
ACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAG
GAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAG
GGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGA
AGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGACGCATTGGGT
CAACAGTATAGAACCGTGGATGATGTGGTCTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTT
GCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGA
TGCGGCCAGCAAAACTAAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCA
ATTTAATTATATCAGTTATTACCCATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTA
TTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTG
AAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTC
GCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGATACACTATTATCCCGTATTG
ACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCA
CAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACA
CTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGG
ATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGAGTGACACCA
CGATGCCTGTAGCAATGCCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGC
AACAATTAATAGACTGAATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCT
GGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATG
GTAAGCGCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGA
TCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGA
TTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAA
TCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATC
CTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG
ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTC
TAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCC
TGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGG
ATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCG
AACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATC
CGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATA
GTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTAT
GGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGGCTTTTGCTGGCCTTTTGCTCACATGTTCTTTC
CTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCC
GAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCG
CGCGTTGGCCGATTCATTAATGCAG



More information about the Yeast mailing list