YEAST UNABLE TO GROW ON SUCROSE

news at mlucom4.urz.uni-halle.de news at mlucom4.urz.uni-halle.de
Wed Sep 1 03:13:38 EST 1999


The reference is:

Riesmeier JW, et al.           [See Related Articles] 
     Isolation and characterization of a sucrose carrier cDNA from
spinach by functional
     expression in yeast. 
     EMBO J. 1992 Dec;11(13):4705-13. 

Good luck
Ricky

ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG

Frederik Boernke
Research Group of  Molecular Plant Physiology
Institute for Plant Genetics and Crop Plant Research (IPK)
Corrensstr. 3
06466 Gatersleben
Tel.  039482 -5 321
Fax. 039482 -5 515
http://www.ipk-gatersleben.de




______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe: e-mail biosci-server at net.bio.net with: subscribe yeast
unsubscribe: e-mail biosci-server at net.bio.net with: unsubscribe yeast
YEAST on the WWW: http://genome-www.stanford.edu/Saccharomyces/VL-yeast.html
problems with the YEAST newsgroup? E-mail the moderator: francis at cmmt.ubc.ca




More information about the Yeast mailing list