YEAST UNABLE TO GROW ON SUCROSE

Francis Ouellette francis at monod.cmmt.ubc.ca
Wed Sep 1 03:14:06 EST 1999


> From: news at mlucom4.urz.uni-halle.de
> Subject: Re: YEAST UNABLE TO GROW ON SUCROSE

> have a look at PubMed and search for "Riesmeier J". He describes
> the cloning of sucrose transporters by complementation of an 
> invertase deficient yeast mutant. If I remember right.


I found this:

http://www.ncbi.nlm.nih.gov/htbin-post/Entrez/query?uid=1464305&form=6&db=m&Dopt=
b

which appears to be the right paper.

> EMBO J 1992 Dec;11(13):4705-13 
> 
> Isolation and characterization of a sucrose carrier 
> cDNA from spinach by functional expression in yeast.
> 
> Riesmeier JW, Willmitzer L, Frommer WB

> PMID: 1464305, UI: 93099843 


cheers,

f.

--
| B.F. Francis Ouellette                     tel: (604) 875-3815  | 
| Director, Bioinformatics Core Facility     fax: (604) 875-3840  | 
| CMMT, UBC, Canada                         eFax: (425) 740-6978  | 
| francis at cmmt.ubc.ca                     http://www.cmmt.ubc.ca  |




> Ricky 
> 
> ATGCATCGTGATCAATCGTATCCCGTGGAAGTACGTACGTAGCACGG
> 
> Frederik Boernke
> Research Group of  Molecular Plant Physiology
> Institute for Plant Genetics and Crop Plant Research (IPK)
> Corrensstr. 3
> 06466 Gatersleben
> Tel.  039482 -5 321
> Fax. 039482 -5 515
> http://www.ipk-gatersleben.de







______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe: e-mail biosci-server at net.bio.net with: subscribe yeast
unsubscribe: e-mail biosci-server at net.bio.net with: unsubscribe yeast
YEAST on the WWW: http://genome-www.stanford.edu/Saccharomyces/VL-yeast.html
problems with the YEAST newsgroup? E-mail the moderator: francis at cmmt.ubc.ca




More information about the Yeast mailing list