vector sequences

David Stillman davidspamcontrol at yahoo.com
Fri Apr 8 16:37:56 EST 2005


We have worked with these vectors. Tatjana is correct, the papers give
no real description of what promoter and terminator fragments were
used. Nonetheless, we have attempted to make sequence files for some
of these plasmids.

We ended up sequencing the insert of one of our constructs, and we
also got the sequence of the GAL1 promoter and CYC1 terminator. I put
the sequence into pRS426, and the sequence of the p426-GAL1 vector is
below.

We have made files for some of the other vectors, with other
promoters, and you can e-mail me to see if we have made them. They
will not be exact, but maybe close (The GAL1 promoter and CYC1
terminator fragments we originally chose were close, but not exact).

David Stillman
University of Utah.
e-mail address: david dot stillman at path dot utah
dot edu
(In an effort to avoid e-mail address sniffers and the
resulting spam)

p426-GAL1
tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccg
gagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccg
tcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatg
cggcatcagagcagattgtactgagagtgcaccataccacagcttttcaa
ttcaattcatcattttttttttattcttttttttgatttcggtttctttg
aaatttttttgattcggtaatctccgaacagaaggaagaacgaaggaagg
agcacagacttagattggtatatatacgcatatgtagtgttgaagaaaca
tgaaattgcccagtattcttaacccaactgcacagaacaaaaacctgcag
gaaacgaagataaatcatgtcgaaagctacatataaggaacgtgctgcta
ctcatcctagtcctgttgctgccaagctatttaatatcatgcacgaaaag
caaacaaacttgtgtgcttcattggatgttcgtaccaccaaggaattact
ggagttagttgaagcattaggtcccaaaatttgtttactaaaaacacatg
tggatatcttgactgatttttccatggagggcacagttaagccgctaaag
gcattatccgccaagtacaattttttactcttcgaagacagaaaatttgc
tgacattggtaatacagtcaaattgcagtactctgcgggtgtatacagaa
tagcagaatgggcagacattacgaatgcacacggtgtggtgggcccaggt
attgttagcggtttgaagcaggcggcagaagaagtaacaaaggaacctag
aggccttttgatgttagcagaattgtcatgcaagggctccctatctactg
gagaatatactaagggtactgttgacattgcgaagagcgacaaagatttt
gttatcggctttattgctcaaagagacatgggtggaagagatgaaggtta
cgattggttgattatgacacccggtgtgggtttagatgacaagggagacg
cattgggtcaacagtatagaaccgtggatgatgtggtctctacaggatct
gacattattattgttggaagaggactatttgcaaagggaagggatgctaa
ggtagagggtgaacgttacagaaaagcaggctgggaagcatatttgagaa
gatgcggccagcaaaactaaaaaactgtattataagtaaatgcatgtata
ctaaactcacaaattagagcttcaatttaattatatcagttattacccta
tgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcagg
aaattgtaaacgttaatattttgttaaaattcgcgttaaatttttgttaa
atcagctcattttttaaccaataggccgaaatcggcaaaatcccttataa
atcaaaagaatagaccgagatagggttgagtgttgttccagtttggaaca
agagtccactattaaagaacgtggactccaacgtcaaagggcgaaaaacc
gtctatcagggcgatggcccactacgtgaaccatcaccctaatcaagttt
tttggggtcgaggtgccgtaaagcactaaatcggaaccctaaagggagcc
cccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaa
gggaagaaagcgaaaggagcgggcgctagggcgctggcaagtgtagcggt
cacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagg
gcgcgtcgcgccattcgccattcaggctgcgcaactgttgggaagggcga
tcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgc
tgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgtt
gtaaaacgacggccagtgagcgcgcgtaatacgactcactatagggcgaa
ttgggtaccCGAGCGTCCCAAAACCTTCTCAAGCAAGGTTTTCAGTATAA
TGTTACATGCGTACACGCGTTTGTACAGAAAAAAAAGAAAAATTTGAAAT
ATAAATAACGTTCTTAATACTAACATAACTATTAAAAAAAATAAATAGGG
ACCTAGACTTCAGGTTGTCTAACTCCTTCCTTTTCGGTTAGAGCGGATGT
GGGAGGAGGGCGTGAATGTAAGCGTGACATAACTAATTACATGActcgag
gtcgacggtatcgataagcttgatatcgaattcctgcagcccgggggatc
cactagttctagaATCCGGGGTTTTTTCTCCTTGACGTTAAAGTATAGAG
GTATATTAACAATTTTTTGTTGATACTTTTATTACATTTGAATAAGAAGT
AATACAAACCGAAAATGTTGAAAGTATTAGTTAAAGTGGTTATGCAGTTT
TTGCATTTATATATCTGTTAATAGATCAAAAATCATCGCTTCGCTGATTA
ATTACCCCAGAAATAAGGCTAAAAAACTAATCGCATTATCATCCTATGGT
TGTTAATTTGATTCGTTCATTTGAAGGTTTGTGGGGCCAGGTTACTGCCA
ATTTTTCCTCTTCATAACCATAAAAGCTAGTATTGTAGAATCTTTATTGT
TCGGAGCAGTGCGGCGCGAGGCACATCTGCGTTTCAGGAACGCGACCGGT
GAAGACGAGGACGCACGGAGGAGAGTCTTCCTTCGGAGGGCTGTCACCCG
CTCGGCGGCTTCTAATCCGTACTAgagctccagcttttgttccctttagt
gagggttaattgcgcgcttggcgtaatcatggtcatagctgtttcctgtg
tgaaattgttatccgctcacaattccacacaacataggagccggaagcat
aaagtgtaaagcctggggtgcctaatgagtgaggtaactcacattaattg
cgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctg
cattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcg
ctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgc
ggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaa
tcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggc
caggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcc
cccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaac
ccgacaggactataaagataccaggcgtttccccctggaagctccctcgt
gcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttc
tcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctc
agttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccc
cgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtcca
acccggtaagacacgacttatcgccactggcagcagccactggtaacagg
attagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtg
gcctaactacggctacactagaaggacagtatttggtatctgcgctctgc
tgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaa
caaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattac
gcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggt
ctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgaga
ttatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttt
taaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaat
gcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatcc
atagttgcctgactccccgtcgtgtagataactacgatacgggagggctt
accatctggccccagtgctgcaatgataccgcgagacccacgctcaccgg
ctccagatttatcagcaataaaccagccagccggaagggccgagcgcaga
agtggtcctgcaactttatccgcctccatccagtctattaattgttgccg
ggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttg
ccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttca
ttcagctccggttcccaacgatcaaggcgagttacatgatcccccatgtt
gtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagta
agttggccgcagtgttatcactcatggttatggcagcactgcataattct
cttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactc
aaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcc
cggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtg
ctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttacc
gctgttgagatccagttcgatgtaacccactcgtgcacccaactgatctt
cagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaagg
caaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatact
catactcttcctttttcaatattattgaagcatttatcagggttattgtc
tcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggg
gttccgcgcacatttccccgaaaagtgccacctgaacgaagcatctgtgc
ttcattttgtagaacaaaaatgcaacgcgagagcgctaatttttcaaaca
aagaatctgagctgcatttttacagaacagaaatgcaacgcgaaagcgct
attttaccaacgaagaatctgtgcttcatttttgtaaaacaaaaatgcaa
cgcgagagcgctaatttttcaaacaaagaatctgagctgcatttttacag
aacagaaatgcaacgcgagagcgctattttaccaacaaagaatctatact
tcttttttgttctacaaaaatgcatcccgagagcgctatttttctaacaa
agcatcttagattactttttttctcctttgtgcgctctataatgcagtct
cttgataactttttgcactgtaggtccgttaaggttagaagaaggctact
ttggtgtctattttctcttccataaaaaaagcctgactccacttcccgcg
tttactgattactagcgaagctgcgggtgcattttttcaagataaaggca
tccccgattatattctataccgatgtggattgcgcatactttgtgaacag
aaagtgatagcgttgatgattcttcattggtcagaaaattatgaacggtt
tcttctattttgtctctatatactacgtataggaaatgtttacattttcg
tattgttttcgattcactctatgaatagttcttactacaatttttttgtc
taaagagtaatactagagataaacataaaaaatgtagaggtcgagtttag
atgcaagttcaaggagcgaaaggtggatgggtaggttatatagggatata
gcacagagatatatagcaaagagatacttttgagcaatgtttgtggaagc
ggtattcgcaatattttagtagctcgttacagtccggtgcgtttttggtt
ttttgaaagtgcgtcttcagagcgcttttggttttcaaaagcgctctgaa
gttcctatactttctagagaataggaacttcggaataggaacttcaaagc
gtttccgaaaacgagcgcttccgaaaatgcaacgcgagctgcgcacatac
agctcactgttcacgtcgcacctatatctgcgtgttgcctgtatatatat
atacatgagaagaacggcatagtgcgtgtttatgcttaaatgcgtactta
tatgcgtctatttatgtaggatgaaaggtagtctagtacctcctgtgata
ttatcccattccatgcggggtatcgtatgcttccttcagcactacccttt
agctgttctatatgctgccactcctcaattggattagtctcatccttcaa
tgctatcatttcctttgatattggatcatactaagaaaccattattatca
tgacattaacctataaaaataggcgtatcacgaggccctttcgtc

______________O_________oO_____________oO______o_______oO___________________
YEAST bionet newsgroup see: http://www.bio.net/hypermail/YEAST/
YEAST e-mail: messages sent to yeast at net.bio.net
subscribe:   mailto:biosci-server at net.bio.net and say: subscribe yeast
unsubscribe: mailto:biosci-server at net.bio.net and say: unsubscribe yeast
YEAST on the WWW: http://www.yeastgenome.org/VL-yeast.html
Newsgroup Moderator SGD Curators: yeast-biosci-moderator at yeastgenome.org




More information about the Yeast mailing list