From barnett from microbio.emory.edu Thu Mar 13 08:43:39 2008 From: barnett from microbio.emory.edu (Tim Barnett) Date: Thu Mar 13 12:04:49 2008 Subject: [Yeast] pAC45 (pPS904) sequence? Message-ID: I am looking for a sequence for the vector pAC45, also known as pPS904. Thanks, - Tim -------------- next part -------------- An HTML attachment was scrubbed... URL: http://www.bio.net/bionet/mm/yeast/attachments/20080313/bcd4e202/attachment.html From taskan4 from gmail.com Fri Mar 14 05:44:57 2008 From: taskan4 from gmail.com (TR) Date: Fri Mar 14 08:04:57 2008 Subject: [Yeast] cheap micromanipulator Message-ID: <70272d730803140344m217cb48cx4aab07828f39d8d4@mail.gmail.com> Dear all, We are looking for a simple and cheap micromanipulator that we could use to position single fungal conidia in an ordered array on a Petri dish. In the "distant" past I have used micromanipulators designed for yeast tetrad disection that were really simple (and presumably cheap): they basically looked just a group of screws attached to an inverted microscope. I have not been able to find one of those now. Does anybody know who sells them? I have seen the nice tetrad disection microscopes sold by Singer instruments, but we really do not need such a complicated and expensive equipment. TR From chenpv from gmail.com Fri Mar 14 13:13:52 2008 From: chenpv from gmail.com (Wei Chen) Date: Sat Mar 15 00:37:51 2008 Subject: [Yeast] pAC45 (pPS904) sequence? Message-ID: Hi Tim, Though I am not so sure, lots of references seem to hint pPS904 was originally known as pKG5 in this article: Kahana, J., Schnapp, B.J.,Silver, P.A. (1995) PNAS 92:9707-9711. In its materials section, the author wrote the following: Plasmid pKG5 was constructed as follows: wild-type GFP was PCR- amplified from plasmid TU65 (5) using the 5' Xho I-linked primer CCGCTCGAGCTATGAGTAAAGGAGAAGA and the 3' 17 primer. The PCR product was cut with Xho I and Pst I (New England Biolabs). The NUF2 open reading frame was amplified from plasmid pPS511 (4) using the BamHI-linked 5' primer GCGGATCCATGAGTAGGAATCAAGATGTC and the in-frame, XhoI-linked 3' primer CCCTCGAGCTTGCATATATTCGAGCATCCCTCGAGCTTGCATATATTCGAGCAT. The PCR product was cut with BamHI and Xho I. The two fragments were ligated together into plasmid pPS293 (a 2-gm URA3 vector with the GALl promoter sequence) cut with BamHI and Pst I. So the backbone of pPS904 is just double digested pPS293, whereas the insert is concatenation of GFP and NUF2. Cheers, Wei __________________________________ Wei Chen Laboratory of Yeast Genetics, 6131 Department of Microbiology College of Life Sciences, Wuhan University Wuhan, 430072 PR. China -------------- next part -------------- An HTML attachment was scrubbed... URL: http://www.bio.net/bionet/mm/yeast/attachments/20080315/a754dba8/attachment.html From albert from zoology.ubc.ca Mon Mar 17 13:36:03 2008 From: albert from zoology.ubc.ca (albert@zoology.ubc.ca) Date: Tue Mar 18 09:35:15 2008 Subject: [Yeast] easy to amplify genes (Chr9 and others) Message-ID: <51783.137.82.4.22.1205778963.squirrel@webmail.zoology.ubc.ca> Hello, We have a strain of yeast (Saccharomyces cerevisiae) in our lab that is aneuploid for Chr IX. We'd like to screen for individuals that are euploid. With that goal in mind we're planning on running real time pcr of a couple of genes on Chr IX, and a couple of genes elsewhere in the genome for reference. Not having worked much with yeast genomics before I was hoping that someone might be able to recommend some genes that are robust and easy to amplify. Thanks in advance for your help! Arianne Albert --------------------- Arianne Albert NSERC Postdoctoral Fellow Simon Fraser University and University of British Columbia --------------------- From clandry from post.harvard.edu Mon Mar 17 14:22:09 2008 From: clandry from post.harvard.edu (Christian Landry) Date: Tue Mar 18 09:35:20 2008 Subject: [Yeast] K. waltii Message-ID: <9AFB6935-42AF-4A05-A72A-725F51A72881@post.harvard.edu> Hi, I am looking for the strain of Kluyveromyces waltii that was sequenced or a strain with an isogenic background (preferably haploid, and with markers if possible). Please contact me if you can help or know where I could obtain it. Thanks, Christian Landry c.landry@umontreal.ca -------------- next part -------------- An HTML attachment was scrubbed... URL: http://www.bio.net/bionet/mm/yeast/attachments/20080317/0092c4ec/attachment.html From S.Wang from uws.edu.au Tue Mar 18 00:04:25 2008 From: S.Wang from uws.edu.au (Shaoyu Wang) Date: Tue Mar 18 09:35:27 2008 Subject: [Yeast] Finding homologe genes in human References: <200801261704.m0QH4WL06267@net.bio.net> Message-ID: Dear All, I need to find human homologe genes of a list of yeast genes. I know how to get human homologe gene one by one but this is tedious if you have say 50 genes to do. I wonder is there any tool we can use to find list of homologe genes at one go? Thank you for your help. Cheers Cindy ________________________________ From: yeast-bounces@oat.bio.indiana.edu on behalf of yeast-request@oat.bio.indiana.edu Sent: Sun 27/01/2008 4:04 AM To: yeast@magpie.bio.indiana.edu Subject: Yeast Digest, Vol 32, Issue 6 Send Yeast mailing list submissions to yeast@net.bio.net To subscribe or unsubscribe via the World Wide Web, visit http://www.bio.net/biomail/listinfo/yeast or, via email, send a message with subject or body 'help' to yeast-request@net.bio.net You can reach the person managing the list at yeast-owner@net.bio.net When replying, please edit your Subject line so it is more specific than "Re: Contents of Yeast digest..." Today's Topics: 1. Re: Unwanted digestion of solubilized membrane proteins. (Martin Kampmann) ---------------------------------------------------------------------- Message: 1 Date: Fri, 25 Jan 2008 12:28:42 -0500 From: Martin Kampmann Subject: [Yeast] Re: Unwanted digestion of solubilized membrane proteins. To: yeast@oat.bio.indiana.edu Message-ID: <4CBFABEC-9562-40F2-80A7-3F8C3145C39A@rockefeller.edu> Content-Type: text/plain; charset=US-ASCII; delsp=yes; format=flowed Hi Linnea, Degradation may occur during your 1 hour solubilization step. Maybe you could try to do 10 minutes of solubilization before the clearing step, and then analyze your sample directly after clearing? Best, Martin On Jan 25, 2008, at 12:07 PM, yeast-request@oat.bio.indiana.edu wrote: > Send Yeast mailing list submissions to > yeast@net.bio.net > > To subscribe or unsubscribe via the World Wide Web, visit > http://www.bio.net/biomail/listinfo/yeast > or, via email, send a message with subject or body 'help' to > yeast-request@net.bio.net > > You can reach the person managing the list at > yeast-owner@net.bio.net > > When replying, please edit your Subject line so it is more specific > than "Re: Contents of Yeast digest..." > > > Today's Topics: > > 1. Unwanted digestion of solubilized membrane proteins. > (Linnea Hedin) > > > ---------------------------------------------------------------------- > > Message: 1 > Date: Thu, 24 Jan 2008 22:17:25 +0100 > From: Linnea Hedin > Subject: [Yeast] Unwanted digestion of solubilized membrane proteins. > To: yeast@magpie.bio.indiana.edu > Message-ID: <47990065.8060607@sbc.su.se> > Content-Type: text/plain; charset="us-ascii" > > An HTML attachment was scrubbed... > URL: http://www.bio.net/bionet/mm/yeast/attachments/20080124/ > fe667810/attachment-0001.html > > ------------------------------ > > _______________________________________________ > Yeast mailing list > Yeast@net.bio.net > http://www.bio.net/biomail/listinfo/yeast > > End of Yeast Digest, Vol 32, Issue 5 > ************************************ ------------------------------ _______________________________________________ Yeast mailing list Yeast@net.bio.net http://www.bio.net/biomail/listinfo/yeast End of Yeast Digest, Vol 32, Issue 6 ************************************ -------------- next part -------------- A non-text attachment was scrubbed... Name: not available Type: application/ms-tnef Size: 7000 bytes Desc: not available Url : http://www.bio.net/bionet/mm/yeast/attachments/20080318/b4816e8f/attachment-0001.bin From carl from singerinst.co.uk Tue Mar 18 06:26:47 2008 From: carl from singerinst.co.uk (Carl Singer) Date: Tue Mar 18 09:35:31 2008 Subject: [Yeast] RE: Yeast Digest, Vol 34, Issue 1 Message-ID: <6A07904B626BB9479F7AAE1C96B0B549250372@sincoserver.SINCOINTL.local> I love the description of "just a group of screws attached to an inverted Microscope". When I started looking at all the available micromanipulators for yeast in the early eighties, many were just that and they required to operate a level of persistence beyond that of most ordinary human beings. Out MSM Manual provides everything that you need in one easy-to-use and imminently affordable package which makes a once specialist task available to everyone. Please email me for further details. We sometimes have refurbished instruments from trade-ins when labs upgrade. Best wishes. Carl Singer | Managing Director SingerInstrument Co. Ltd. www.singerinstruments.co.uk yeast@singerinst.co.uk T: +44 (0)1984 640226 F: +44 (0)1984 641166 Singer Instruments.... A responsibility to science This email and any files transmitted with it are confidential and intended solely for the use of the individual or entity to whom they are addressed. If you have received this email in error please notify the system manager. Note that any views or opinions presented in this email are those of the author alone and do not necessarily represent those of the company. Our emails and their contents are scanned for viruses prior to sending however Singer Instruments accepts no liability for any damage caused by any virus transmitted by this email. -----Original Message----- From: yeast-bounces@oat.bio.indiana.edu [mailto:yeast-bounces@oat.bio.indiana.edu] On Behalf Of yeast-request@oat.bio.indiana.edu Sent: 14 March 2008 17:05 To: yeast@magpie.bio.indiana.edu Subject: Yeast Digest, Vol 34, Issue 1 Send Yeast mailing list submissions to yeast@net.bio.net To subscribe or unsubscribe via the World Wide Web, visit http://www.bio.net/biomail/listinfo/yeast or, via email, send a message with subject or body 'help' to yeast-request@net.bio.net You can reach the person managing the list at yeast-owner@net.bio.net When replying, please edit your Subject line so it is more specific than "Re: Contents of Yeast digest..." Today's Topics: 1. pAC45 (pPS904) sequence? (Tim Barnett) 2. cheap micromanipulator (TR) ---------------------------------------------------------------------- Message: 1 Date: Thu, 13 Mar 2008 09:43:39 -0400 From: "Tim Barnett" Subject: [Yeast] pAC45 (pPS904) sequence? To: "yeast@net.bio.net" Message-ID: Content-Type: text/plain; charset="us-ascii" I am looking for a sequence for the vector pAC45, also known as pPS904. Thanks, - Tim -------------- next part -------------- An HTML attachment was scrubbed... URL: http://www.bio.net/bionet/mm/yeast/attachments/20080313/bcd4e202/attachm ent-0001.html ------------------------------ Message: 2 Date: Fri, 14 Mar 2008 10:44:57 +0000 From: TR Subject: [Yeast] cheap micromanipulator To: yeast@magpie.bio.indiana.edu Message-ID: <70272d730803140344m217cb48cx4aab07828f39d8d4@mail.gmail.com> Content-Type: text/plain; charset=ISO-8859-1 Dear all, We are looking for a simple and cheap micromanipulator that we could use to position single fungal conidia in an ordered array on a Petri dish. In the "distant" past I have used micromanipulators designed for yeast tetrad disection that were really simple (and presumably cheap): they basically looked just a group of screws attached to an inverted microscope. I have not been able to find one of those now. Does anybody know who sells them? I have seen the nice tetrad disection microscopes sold by Singer instruments, but we really do not need such a complicated and expensive equipment. TR ------------------------------ _______________________________________________ Yeast mailing list Yeast@net.bio.net http://www.bio.net/biomail/listinfo/yeast End of Yeast Digest, Vol 34, Issue 1 ************************************ From maria from genome.stanford.edu Tue Mar 18 09:46:52 2008 From: maria from genome.stanford.edu (Maria Costanzo) Date: Wed Mar 19 18:26:05 2008 Subject: [Yeast] Finding homologe genes in human In-Reply-To: References: <200801261704.m0QH4WL06267@net.bio.net> Message-ID: <47DFD5DC.3050804@genome.stanford.edu> An HTML attachment was scrubbed... URL: http://www.bio.net/bionet/mm/yeast/attachments/20080318/19201089/attachment.html