pCS2+ vector sequence

Chi-Bin Chien chi-bin.chien at hsc.utah.edu
Fri Mar 17 12:06:19 EST 2000


David Mawdsley asked:

>I need the complete sequence of the pCS2+ vector but can't seem
>to find it in any database.  Does anyone know where I can get it?

Here is the sequence, which I got from David Turner (who originally
constructed pCS2+) several years ago. Total length=4095 bp.

===========
CGCCATTCTGCCTGGGGACGTCGGAGCAAGCTTGATTTAGGTGA
CACTATAGAATACAAGCTACTTGTTCTTTT
TGCAGG
ATCCCATCGATTCGAATTCAAGGCCTCTCGAGCCTCTAGAACTAT
AGTGAGTCGTATTACGTAGATCCAGACAT
GATAAG
ATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA
AAAAATGCTTTATTTGTGAAATTTGTGATG
CTATTG
CTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAA
CAATTGCATTCATTTTATGTTTCAGGTT
CAGGGG
GAGGTGTGGGAGGTTTTTTAATTCGCGGCCGCGGCGCCAATGCA
TTGGGCCCGGTACCCAGCTTTTGTTCCCTT
TAGTGA
GGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCT
GTGTGAAATTGTTATCCGCTCACAATTCC
ACACAA
CATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAA
TGAGTGAGCTAACTCACATTAATTGCGTTGC
GCTCAC
TGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAAT
GAATCGGCCAACGCGCGGGGAGAGGCGGT
TTGCGT
ATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCG
GTCGTTCGGCTGCGGCGAGCGGTATCAGC
TCACTC
AAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCA
GGAAAGAACATGTGAGCAAAAGGCCAGCAAA
AGGCCA
GGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTC
CGCCCCCCTGACGAGCATCACAAAAATCGA
CGCTCA
AGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG
CGTTTCCCCCTGGAAGCTCCCTCGTGCGCTC
TCCTGT
TCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTC
GGGAAGCGTGGCGCTTTCTCATAGCTCAC
GCTGTA
GGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGT
GTGCACGAACCCCCCGTTCAGCCCGACCGC
TGCGCC
TTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGAC
TTATCGCCACTGGCAGCAGCCACTGGTAA
CAGGAT
TAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGT
GGTGGCCTAACTACGGCTACACTAGAAGGA
CAGTAT
TTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGA
GTTGGTAGCTCTTGATCCGGCAAACAAACC
ACCGCT
GGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGA
AAAAAAGGATCTCAAGAAGATCCTTTGAT
CTTTTC
TACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGG
ATTTTGGTCATGAGATTATCAAAAAGGATCT
TCACCT
AGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTAT
ATATGAGTAAACTTGGTCTGACAGTTAC
CAATGC
TTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCAT
CCATAGTTGCCTGACTCCCCGTCGTGTA
GATAAC
TACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGA
TACCGCGAGACCCACGCTCACCGGCTCCAG
ATTTAT
CAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTG
GTCCTGCAACTTTATCCGCCTCCATCCAGTCT
ATTAAT
TGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTG
CGCAACGTTGTTGCCATTGCTACAGGCAT
CGTGGT
GTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCA
ACGATCAAGGCGAGTTACATGATCCCCCA
TGTTGT
GCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGA
AGTAAGTTGGCCGCAGTGTTATCACTCATG
GTTATG
GCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGC
TTTTCTGTGACTGGTGAGTACTCAACCAA
GTCATT
CTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGT
CAATACGGGATAATACCGCGCCACATAGCA
GAACTT
TAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCT
CAAGGATCTTACCGCTGTTGAGATCCAGT
TCGATG
TAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCA
CCAGCGTTTCTGGGTGAGCAAAAACAGG
AAGGCA
AAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA
ATACTCATACTCTTCCTTTTTCAATATTATT
GAAGCA
TTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTAT
TTAGAAAAATAAACAAATAGGGGTTCCG
CGCACA
TTTCCCCGAAAAGTGCCACCTAAATTGTAAGCGTTAATATTTTGTT
AAAATTCGCGTTAAATTTTTGTTAAATC
AGCTCA
TTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCA
AAAGAATAGACCGAGATAGGGTTGAGTGT
TGTTCC
AGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACG
TCAAAGGGCGAAAAACCGTCTATCAGGGCG
ATGGCC
CACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGT
GCCGTAAAGCACTAAATCGGAACCCTAAA
GGGAGC
CCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGA
GAAAGGAAGGGAAGAAAGCGAAAGGAGCGGG
CGCTAG
GGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACA
CCCGCCGCGCTTAATGCGCCGCTACAGGGCG
CGTCCC
ATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTG
CGGGCCTCTTCGCTATTACGCCAGTCGACC
ATAGCC
AATTCAATATGGCGTATATGGACTCATGCCAATTCAATATGGTGG
ATCTGGACCTGTGCCAATTCAATATGGCG
TATATG
GACTCGTGCCAATTCAATATGGTGGATCTGGACCCCAGCCAATT
CAATATGGCGGACTTGGCACCATGCCAATT
CAATAT
GGCGGACTTGGCACTGTGCCAACTGGGGAGGGGTCTACTTGGC
ACGGTGCCAAGTTTGAGGAGGGGTCTTGGCC
CTGTGC
CAAGTCCGCCATATTGAATTGGCATGGTGCCAATAATGGCGGCC
ATATTGGCTATATGCCAGGATCAATATATA
GGCAAT
ATCCAATATGGCCCTATGCCAATATGGCTATTGGCCAGGTTCAAT
ACTATGTATTGGCCCTATGCCATATAGTA
TTCCAT
ATATGGGTTTTCCTATTGACGTAGATAGCCCCTCCCAATGGGCGG
TCCCATATACCATATATGGGGCTTCCTAA
TACCGC
CCATAGCCACTCCCCCATTGACGTCAATGGTCTCTATATATGGTC
TTTCCTATTGACGTCATATGGGCGGTCCT
ATTGAC
GTATATGGCGCCTCCCCCATTGACGTCAATTACGGTAAATGGCC
CGCCTGGCTCAATGCCCATTGACGTCAATA
GGACCA
CCCACCATTGACGTCAATGGGATGGCTCATTGCCCATTCATATCC
GTTCTCACGCCCCCTATTGACGTCAATGA
CGGTAA
ATGGCCCACTTGGCAGTACATCAATATCTATTAATAGTAACTTGG
CAAGTACATTACTATTGGAAGGACGCCAG
GGTACA
TTGGCAGTACTCCCATTGACGTCAATGGCGGTAAATGGCCCGCG
ATGGCTGCCAAGTACATCCCCATTGACGTC
AATGGG
GAGGGGCAATGACGCAAATGGGCGTTCCATTGACGTAAATGGG
CGGTAGGCGTGCCTAATGGGAGGTCTATATA
AGCAAT GCTCGTTTAGGGAAC ---






More information about the Zbrafish mailing list