IUBio

GenBank : Error in GbUpdate file nc0331.flat

Mark Cavanaugh cavanaug at lagrange.nlm.nih.gov
Fri Mar 31 11:55:49 EST 2000


Greetings GenBank Users,

GenBank Update file nc0331.flat.Z, installed on NCBI's ftp
server at 03:34am (EST) on March 31, 2000, contained a
truncated record:

LOCUS       AP001552   150120 bp    DNA             PLN       30-MAR-2000
DEFINITION  Oryza sativa geneomic DNA, chromosome 1, PAC clone:P0029D06.
ACCESSION   AP001552
VERSION     AP001552.1  GI:7363267
....
    79861 gtaaaatgag aaaacaaaaa tatattgctt ctgtttcgtt tgactttttt cttagtcaat
    79921 gttttttaga tttgactaag tttatagaaa caatggcaat atttaaaaca ctaaLOCUS       
AC022333  
 173907 bp    DNA             PRI       30-MAR-2000
DEFINITION  Homo sapiens Chr3 NOVECTOR RP11-64O13 () complete sequence.
ACCESSION   AC022333


This problem has been fixed, and a new patched version of
nc0331.flat.Z was installed at 11:42am (EST) on March 31.

The ASN.1 version of the update (nc0331.aso.Z) was not affected.

If your processing of this update was incomplete due to the truncated
record, we suggest that you obtain the new version of the file and
re-process.

Our apologies for any inconvenience that this data error has caused.

Mark Cavanaugh
GenBank
NCBI/NLM/NIH


---



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  







More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net