IUBio

Finding Reprint Authors' E-Mail Addresses

Richard Gordon gordonr at Ms.UManitoba.CA
Wed Feb 7 05:34:51 EST 2001


Eric Cowdrey and I have put together a web page that makes it 
relatively easy to find the e-mail addresses of academic colleagues, 
for the purpose of requesting reprints:

Finding Reprint Authors' E-Mail Addresses 
http://www.umanitoba.ca/faculties/medicine/radiology/search/searchindex.html

There are no a d v e r t i s e m e n t s or costs. If you use it, 
please let us know of omissions, corrections, or improvements you'd 
like, and forward it to your colleagues.
-- 

Dr. Richard Gordon, Radiology, University of Manitoba, HSC Rm. GA216, 
820 Sherbrook St.
Winnipeg R3A 1R9 Canada
Adjunct: Electrical & Computer Engineering, Exec Member: CSTB, CARRF, IEEE-EMBS
phone:(204)789-3828, fax:(204)787-2080, e-mail: GordonR at ms.umanitoba.ca
New book: The Hierarchical Genome & Differentiation Waves: Novel 
Unification of Development, Genetics & Evolution: 
http://www.wspc.com.sg/books/lifesci/2755.html
Finding Reprint Authors' E-Mail Addresses: 
http://www.umanitoba.ca/faculties/medicine/radiology/search/searchindex.html 


---


- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  








More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net