IUBio

Loop formation, deletions...with PCR

Kitchen, Chad chad_kitchen at URMC.Rochester.edu
Fri May 18 11:03:23 EST 2001


I am wondering whether anyone has experienced "skipping" of segments flanked
by long, direct repeats while performing PCR.  We used a template (Contig
clone, human genomic, sequence is published), and obtained a pcr product
~100bp less than expected size.  Our sequencing of the resultant clone
indicates a 100bp deletion, flanked by CCagCCCCCC (5'-3').  Could a loop
have formed such that Taq polymerase read right through?  Any experiences
would be helpful.  Thanks!!!!
Chad M. Kitchen
Technical Associate I
Center for Cardiovascular Research, Box 679
University of Rochester Medical Center
Ph. 716-273-1535

---



- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/       
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb      
- GenBank on the WWW, see:  http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca                  





More information about the Genbankb mailing list

Send comments to us at biosci-help [At] net.bio.net