Greetings GenBank Users,
GenBank Release 129.0 is now available via ftp from the National Center
for Biotechnology Information (NCBI):
Ftp Site Directory Contents
---------------- --------- ---------------------------------------
ftp.ncbi.nih.gov genbank GenBank Release 129.0 flatfiles
ncbi-asn1 ASN.1 data used to create Release 129.0
Uncompressed, the Release 129.0 flatfiles require roughly 66.43 GB
(sequence files only) or 74.72 GB (including the 'short directory' and
'index' files). The ASN.1 version requires roughly 57.43 GB. From the
release notes:
Release Date Base Pairs Entries
128 Feb 2002 17089143893 15465325
129 Apr 2002 19072679701 16769983
Close-of-data was 04/22/2002. Four working days were required to prepare
this release. In the nine-week period between close-of-data for GenBank
releases 128.0 and 129.0, GenBank grew by 1.983 billion basepairs and by
1,304,658 sequence records. During that same period, 183,976 records were
updated. Combined, this yields an average of just over 23,600 new/updated
records per day.
We would like to remind our users that GenBank mirrors are available
at ftp://genbank.sdsc.edu/pub and ftp://bio-mirror.net/biomirror/genbank .
Those who experience slow FTP transfers of large files (entire releases, the
GenBank Cumulative Update, etc) might realize an improvement in transfer
rates from these alternate sites when traffic at the NCBI is high.
For additional release information, see the README files in either of the
directories mentioned above, and the release notes (gbrel.txt) in the
genbank directory. Sections 1.3 and 1.4 of the release notes (Changes in
Release 129.0 and Upcoming Changes) have been appended below.
Release 129.0 data are currently available via NCBI's Entrez and Blast
servers, and the 'query' email server.
New GenBank cumulative update files (gbcu.flat.Z and gbcu.aso.Z), containing
only those entries new/updated since the Release 129.0 close-of-data, should be
available by 10:00am EST, April 27. Please note that the new CUs will be
smaller than previous versions you might have obtained after Release 128.0 was
posted.
If you encounter problems while ftp'ing or uncompressing Release 129.0,
please send email outlining your difficulties to info at ncbi.nlm.nih.gov .
Mark Cavanaugh, Vladimir Alekseyev, Anton Butanaev
GenBank
NCBI/NLM/NIH
1.3 Important Changes in Release 129.0
1.3.1 Organizational changes
Due to database growth, the EST division is now being split into 161 pieces.
Due to database growth, the GSS division is now being split into 51 pieces.
Due to database growth, the HTG division is now being split into 33 pieces.
Due to database growth, the PRI division is now being split into 19 pieces.
Due to database growth, the ROD division is now being split into 3 pieces.
Due to database growth, the VRL division is now being split into 3 pieces.
1.3.2 New REFERENCE type for on-line journals
Agreement was reached at the May 1999 collaborative DDBJ/EMBL/GenBank
meeting that an effort should be made to accomodate references which are
published only on-line. Until specifications for such references are
available from library organizations, GenBank will begin to present them in
the following manner, as of this April 2002 GenBank Release :
REFERENCE 1 (bases 1 to 2858)
AUTHORS Smith, J.
TITLE Cloning and expression of a phospholipase gene
JOURNAL Online Publication
REMARK Online-Journal-name; Article Identifier; URL
1.3.3 GSS File Header Problem
GSS sequences at GenBank are maintained in one of two different systems,
depending on their origin. One recent change to release processing involves
the parallelization of the dumps from those systems. Because the second dump
(for example) has no prior knowledge of exactly how many GSS files will be
dumped from the first, it doesn't know how to number it's own output files.
There is thus a discrepancy between the filenames and file headers of eight
GSS flatfiles in Release 129.0. Consider the gbgss44.seq file:
GBGSS1.SEQ Genetic Sequence Data Bank
April 15 2002
NCBI-GenBank Flat File Release 129
GSS Sequences (Part 1)
Here, the filename and part number in the header is "1", though the file
has been renamed as "44" based on the files dumped from the other system.
We will work to resolve this discrepancy in future releases, but the priority
is admittedly much lower than many other tasks.
1.4 Upcoming Changes
1.4.1 New CONSRTM linetype for references.
In order to capture the names of consortia and other groups that are involved
in large-scale sequencing projects, a new linetype called CONSRTM will become
legal in the REFERENCE block of the GenBank flatfile format as of June, 2002 .
Consider, for example, the literature citation associated with PubMed
identifier 11237011 :
Nature 2001 Feb 15;409(6822):860-921
Initial sequencing and analysis of the human genome.
In addition to the very long list of author names, a consortium is associated
with this publication:
International Human Genome Sequencing Consortium
With the addition of a CONSRTM linetype, collective names like this will
have a dedicated location in the flatfile format. Records which currently
attempt to force consortium names into the last entry of the AUTHORS line
will be updated to utilize the new linetype.
Note that multiple consortia for a REFERENCE may exist, in which case
they will be separated by a semi-colon. It is also possible that references
with a CONSRTM linetype will not have any individual AUTHORS at all.
1.4.2 Selenocysteine representation
Selenocysteine residues within the protein translations of coding
region features have been represented in GenBank via the letter 'X'
and a /transl_except qualifier. At the May 1999 DDBJ/EMBL/GenBank
collaborative meeting, it was learned that IUPAC plans to adopt the
letter 'U' for selenocysteine.
DDBJ, EMBL, and GenBank will thus use this new amino acid abbreviation
for its /translation qualifiers. Although a timetable for its appearance
has not been finalized, we are mentioning this now because the introduction
of a new residue abbreviation is a fairly fundamental change.
Details about the use of 'U' will be made available via these release
notes and the GenBank newsgroup as they become available.
---
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca