Hi
I hope that somebody would be able to help me! I am looking for
database or plain text file (or something else) to find relation between
accession numbers in genbank and swissprot databases. I need data that I can
input to my own database and make queries from my local database. The
second option would be the public database that is accessible from my
local computer through command line programs (perl scripts etc.).
The problem: In genbank there might be numerous different accession
numbers that actually point to sequences that are derived from the one
specific gene. One accession number may identify cDNA, another exon1 and
so forth. I would like to find a common denominator to all these
genbank accession numbers from swissprot database.
Teemu
- gttaacaattaaagagtgtttatcgaaattcattatatagtggtttatatagaccacttc
-
- GenBank newsgroup see: http://www.bio.net/hypermail/genbankb/
- GENBANKB e-mail: messages sent to genbankb at net.bio.net
- subscribe: e-mail biosci-server at net.bio.net with: subscribe genbankb
- unsub: e-mail biosci-server at net.bio.net with: unsubscribe genbankb
- GenBank on the WWW, see: http://www.ncbi.nlm.nih.gov/Genbank/
- problems with GENBANKB? E-mail moderator: francis at cmmt.ubc.ca